Description :
From Genome Similarity Track
Location :
Scaffold_182:26963- 28204
Transcript NameFunction/comments
Albla_Nc14092880pantothenate kinase putative

Sequence
1241 bases(100 bases per row)
GTATGGACATTGGAGGTACCTTGGCGAAGATAGTATACCTGGAAAAGCATCACACAGTCGAGGCAGATAAGTGTATAGAAGCCAATCCGAAACGGAGCCG
TTCGCCATCTTTGGAAGTGGTTCGTAGCGAAATGAATAAATTCGTCAATGAGAACGAGCATTTCGGTCAGTCAGGCGTGCGTGATGTCCGTCTCCACATG
CATTTGAAGGAGTTTGAAGGAGTAAGTTTCCAATTTTGTATCCTAATCTTTTGATTCGATTCTGTGGATTGCAGACATTCCATTTCATTCGATTTGAGTC
CAGTCACACAGCCGAAGCGATCAACTTGATTTCCGAACATGGACTCAATCAGTCTTTGCGTATTCTTCCATGCACGGGCGGCGGGGCATACAAAGTGAGA
AGTATTTTTCCTTTTCCATGGACCTACAGTACTGTATTTCTTTGTGTTCTTCCAGTACGCGCAGTTGTTTTCTGACATGGCCGCCATTGAACTCAAAAAG
TATGATGAGATTGAATGTATACTTCGAGGTCTCAATTTGCTGCTGGCAACTGTACCCGATGAAGTCTTCACATTTAAGGTTCGTTCTCTAGTCCCCACAA
TCGCTGTCTTCCATCCACTGCAGAGTCTTGATGCAGGATATGGATCTTGAATCGTTTTCCGCCTCGCGAGTGCGCACGGTTCCTTTTGATCAAGACAAAG
TATTTCCTTACCTGCTTGTCAGCATTGGCTCGGGCGTGAGTATATTACATGTCAAAGGTCCAGAAGATTTTGATCGCGTCAGCGGAAGTAGCATTGGCGG
AGGAACGTACTGGGGCCTGTGTCGATTGCTCACAAAATGTAAAAGCTACGACGAAGCGCTGGATGTATGTGTGCATGGAACCAACTCGACAGTTGATATG
AGTGTTGGGGATATCTACGGTGGAGCGTACGACAAATTTGATCTCCCGGCGTCAACAGTAGCCAGCAGTTTTGGCAAAATGATCTCTGCTCTCCATCCTG
TATGCGACGCCGATCTAGCACGTGCATTGCTGGTGATGATCACTCAAAATATTGGCCAAATCGCATTCCTCAATTCGTGCTTGTATAAAACGAGACAAAT
CTACTTTGTCGGGAACTTTCTTCGTCACAACACGATATCCAGCAAAACACTTGCATTCGCTATCGATTTTTGGTCTAAAGGAACAATGGAAGCTCGATTT
TGTCATCATGAAGGATATTTGGGCGCCTTGGGTGCTTTCTT