Description :
From Genome Similarity Track
Location :
Scaffold_77:269629- 272161
Sequence
2532 bases(100 bases per row)
CGAACAGCAAGTGGATGGATTGGATTATATTAATAGAGACCAGGCGAGATCACAGACACACGTTTCTGGAAGTGAGACCGGCTTCAAAAAAAAAGCTCAA
AGTTTGAAGGAATTTCCATAAATCAGTATATACCTACTGATTTATTGCATGCGCACAAAGAAGTCTTTTTAAAATACTATTTTACAGTTTAACCGTTTCA
CTTGAAGCCAAACCAGCACCGGCGGTATCGGGTCCTGTCCACCCCTTTCAACCTTCATGCTGTCTAGCGAATCCAGACACAATTGATGGTGGAGCCCATG
GGCTCTTGTTGCTGGCCGCTAGCTAGCACTTATTGCTATCGATAAAAGCTGTTTGATGCAGCTCTTTCACATATACTCGGTTTGATTATGTGCCTGATTT
CGACATTGCCACAGTACAGCAAGCCCAAAACTACAAATCGCCCAGACCCTACTTATCGCTTCCACTGCCCATAGCTCCTTACAATTCTGACTTAGAATCG
CGATCCCACTGGAGGTCTCGTACGTGTTGCGAAGCTGTCTTGATAGCTCTTAAACAGCCCCGCTGTTGACTCGCACCCAGTCCAATGCGCAAACATCTTG
CTTCGGAACGCCTGTGCTCTGGTACATTTATATTCCCACGCGATATGGGTGAGTTACAGTGGCAGGTCTCGTCCTGAGGGCAGCCCATGATGTTCGATCC
GGCGTAATACAAATTCATTTGTTTGGCGGCCATTCGGTAGTTGACCCAAACTTGGTAGTCTGTAAGCAGATCTCGGTTCGACCAGAGTTGCTTAGCAGTT
TGATTCGGACCCATGGATTCGTTGCACTGCCAAACATATCACAAAGTCAGTCACTTTAAGTATTAGGTATGCCGTGTTCTCACTAGCAGTGATTTCCGGA
CTGTGATAAGGTTGTTCACAACAGTAAAGAGCTCGGTGATGATGGCTTGGATTGTCAATGACCTCGTACAAGTACTGAGAAGAACACGAGCTCCAAACTT
GTACTTGTATGCGCTAGATCTAGTGTCACGATAAGTTTTCTCTTTTAAAAAAAGAGCTGCAACTGGTGTGGCATGCAAAAAAGAAAACAGTAGGGAGCTA
CTGATTTATGGATATTCCTCTCAGAGTTTGAGTGGATCGTGACGTGCCACGCAGATTTGAACGCCTCGCACGGTGCGAGTCGCACCAATTAAACGAGGTT
CCATTTTCTGTTTTGCTGTTCTTCAAGTATACTTCGGGCTGCAGGCTGGATGCGAGCCTGCAGACTCTGCAGCAGAGCCCAGGCGAGCTGACTCATGCAA
ATTGTTATTACATGTAATCGGAGATTAATAATCGCACGACGACCAGTTTTAGACTGTATAAATAGCTGTATGCGTGTGTGCAGCAGGTTTTGCGGCGATC
ATCGTATCCTAGAGAAGTAACTCACACTAAGCGCGAGGAGGGTACCGCTAATTAATAACAACATACATTAGTATAGAAAGTTGTATACCTCAAGGGTTGG
GCGAGATGGTGAATGAATAGGTTAGCGGCGTAGAAGCTACTTATATCGCGCGTTGTCCGCGAATACGCTGTATATGGATGATTAATATCATTTCTCCGAC
CATACTTGAATAAAATATTAGTATTAATGTCCAATCAGAAAGAATAGCCCGTATTTGGACGAATCATACATCGACTGTGCCAATATTTTGACTAATCAAA
GCACGGTAGGGTCAGTATAGGTCGATAAGAGGCAGCTCCGACATATCGGGTCGGAGGCCCCTCTTGTGTTATTGATATCGGCATACAAACCTCCACTCAT
TAGCATATTTTGCAAATAGCACGCGAGCTCCGACCCCTCCGACGCAAGATGAGTCTGAGCGACCTCGCACCGACAAACACGAAGCGCGCACGGGATGGCG
CGGCACGCATGTTCAAAGCGTTTCTTGAGGAAGAAGGGGTGACATGGGAGTACCTAGAGGTGTGCATGAAGCGCGACAACGCTCCCCGCGTTTTGGAGGC
CGTGGTGGACAAGTTTGGAATGCATCTCGCTTTCAAGGAAGGACGGAAGGGCAGCCTGTTGGCTAGGCACTCAGTCATGCAGTACTACCGACAGGCAAAG
AACTGGTTGCTCGATCAGTTCCCACAGCATCGAGAGGCTGTCGGCAAGGTTCTCCTGAAGAAGGGTCAAGTGCTGGAGCGCTATTGCATGAAGCGAAAGT
CAGGCAATTTTGTGAAGAAGGCACCTGCATGCACGAAGAAAGCACTCAAGCAGATGATGGTGTACCTCTATTCAAATGGTGTAACAGCTTCGGACTACCA
AGACGCGGCGCTGCTGTGCTTGCTCTGGTTTCTGTTTGGCCGAGCCTCTGACATCTCGCTACTCCGGAAGGTGACCTTATCCATCGGTTCGGGGGGAATA
TTTTGCCTGAGGCTGATCCGTGTACAGACGTCCGAAGAACAAGGTCTCTCCCTTTTTTCCGACGACGACTTCGCCACGTGTCCGCTGCTAGCTATCGCTG
TGGCTCTTGCAACTCAATCGGCACCGGCGGCT