Description :
From Genome Similarity Track
Location :
scaffold_361:26959- 30626
Transcript NameFunction/comments
g7653.t1 formin-homology 2 domain-containing protein

Sequence
3667 bases(100 bases per row)
GCCGGACGACGCCTTCGCCCGCGAGCCCGAGTGCGGCGTGTGTACCAAGTCGTTTAACATCTTGCGGCGCCGGCATCACTGCCGCAGCTGCCACATCGCG
CTGTGTAAGGATTGCGGTCGCAAGGCTATTGACCGCAAGAAGCCCGAGCGCTCGAGGCCGCAGTGGTACTGCTTGGGCTGTTTGGACGAGGACGCCACGC
TGGAGATCACGGGCTCGAGGCCGAGTGTGAGCAAGCGCCGCAGCTTCTCTTCGTCGTCGTCTTTCGCCCCGAACAGCCAGCCGCAAGTCACTAATGTGAG
TGTTGTGGATGCCAAGTTGAAGTGAGAAGTTGCCAGGTGGTTTTTGTATCGACTAACGGGTGTTTTTGTGATAGTTGGCGAGCACAGCCAAGTTCTGCAT
TGAGTGCGGCAATGAACTGCCGCCGAGAGTCAAGTTTTGTATTGAATGTGGCACGTCCGTCAGGCAGCAGTTGATGTCGCCCGTCAGTGTGGACGGTGTT
GTGACAGCGGACGGGGATCGCGCGAATCGAGGATTCCGAGACTCATTGGGGACGAATCTCATGGTTATTGACGAGAACAGTGGATCTCCGACGGAACCTA
CGGACGGGTCGGAAGATGACACACCTGCTGATCAAGAACCGGATGAGGACGTATCGATTGAAAAGAAGGTGGAAGTTGAAACGCCCGAAGGGGACGAGGA
TTCAGCAGCAAAAGCGAAGGAATACGAAGAACTGGTAGCGCAACTACAGGCAGAAAACGAGAAGCTGCGTACTCGCGTCGAGAAGTTTAAGCGCAAGATC
TCGGAGGCGGAACGCCGTCGATTAGAGAGGGAGGAGGAGTATGCACGAGCAGTATCCGAGGCCACTGTTGCTGCAGCTGCTGCTGCAACTGCCGCGGCTG
AAGCTCATACGAATAACCGTAGCGTGGCAGAACCAGCGGCTCAGACTGCATCTGCATCGGAACCTGCAGCAGAAGTAGCTCCCGCCAGCAATGGAACGGG
TGTCGCTGCGAAAGACCACCCTGATTACTTGAAGTTTTTTAAGCTGTTGAAGATGGGACTTCCTGCTGAGCAAGTGAAGTTGAAAATGCAAGCGTCAGGC
GTTGATCCGTCAGTCCTTGATGACCCTGATGCGATTATTGGGGGAGCTGCTCCGGTTGCCGATAGCGCTTCAGCCCCACCTCCAGCCTCTGGTAGTACCA
CTGTGAAGGATGACGAGCAGTACGCGAAGTTTTTCAAGCTTCTGAAAATGGGAATGCCTCCTGAGCAAGTTAAGTTGAAAATGAGTGCGAGTGGCCTGAA
CCCAGACCTTCTCGACACGCCGGATGCGCCAATGCCTGGATCCAGCGCTGCAGCACCAGTGGCATCGTCTAACCAGGTCATGACTGTAAAGGAAGACCCG
GCCTACGAAAAATTCTTCAAGCTGGTAAAGATGGGGATGCCTGCTGAGCAAGTAAAAATGAAGATGAGTGCCGCAGGTTTGAATGTGGATTTGCTGGACA
CGCCCGACGCGCCTTCTCCCAACCAGAAGGCGGGTGGTAGTAGCGGAGGTGGTGGCCTTCTTGCTGGGTTGCCTCCTCCGAAGGAAGCAGTCAAGGTGGA
CCCGTCGGCTTTACAGGCAAGCTTGGCATCAAAGTTGGCCAAACCTGTTCCAAAGAAGCCGGAGGAGCCCCAACTTCCTAAGAAGGAGACAGTGAAGCCA
AATGTCGAGTTACGTCCGCTCTTCTGGACTCGCGTTCCAGTCAATGTAGTCAGCAGCACTGTATGGATGAAACTGAACGACTCGCATGCGGAGCTGGATG
TGGAAGAAATGGAGTGGATGTTCCGCAAAAACCCGGTGGATGCCTCGAAAAAGCTGGATGAGAAGAAGAAAGAAGCTGAAAAGGTGCCAGCTCAGCCCAA
GGAAGTACTCCTGTTCGATCCGAAGAGGCAGCAGAACGTATCGATCGCTATTGCCCGGTTTAAAATGTCGTCTGAAGATATCAAGAATGCTATTTACGCT
TTGGATGGCCAGAAACTGGGATCTGAAGTGCTGAACGTGTTAATTTCTATCTCGCCGACACTGGAAGAGATTGATATGCTAAAGAACTACGACGGAGACA
TAAAACTGCTGGGAAACGTGGAGAAGTTTTTCCTCGACTTGCTGACTATCCCGCGCTACACTCAGCGTATCAAGTGCTTTAGATACAAGTTGCAGTTCGA
GAATCGTATCTTGGAGACGCAGGCGCAATTGGATACTCTGGTCGCTGCTACTGATCAGGTGACTGAGAGCGATAAGTTCCGTCGTGTTTTGGAGAATATC
CTGGCTATCGGCAACTACTTGAATGGTAGCACACCGCGTGGTGGCGCCTACGGTTTCAAGCTTGACACTTTAATGAAGCTTCACACGCTGAAGTCGGTTG
ATCCTCGTGTCACATTGATGCACTTTTTGCTGCGCCAACTGGAAGAGAAGACCCCGGACGTCATTACTTTTGCCGGAGAAGTTCCTCACATTGTGGAGGC
GAAGAGGTTGTCTCTCGATCAGCTGCGCGCCGATCTTTCCTCTTACAACACGGAGCTAGCCATGCTCAAGGGCCAAGTCCGTGCTTCGAAGAATGATCAT
ATTGAGGGTGACAAATTTTACGAGGTAATGACCCCATTTGCGAAGGATGCAGAAGAAGTGCTGGAGGAGCTGGGACGTGACTTTAACGGTCTGGAAACTT
CATACCAGGAGCTGGTTAGCTCCTTCGGCGAAGACCCACGTAAGGTTGGCCCCATGGAGTTCTTCACTATTCTGGACGAGTTTGTGACCGAATTCAAAAA
GGCGTACCGCCAAAATCAGACCAAGGAATACCAGGCAATCTACGAGGAGGCCGCCGCAGCCCGTGCTGCTGCCGAGGCAGCGAAGGCTGAACGATTAAAA
CAGGAAGCAGAGGAACGCCAGCGACTAGAAGAGGAGAGGCAGCAGAACTCGCAGGAGACCAAGGCGATTTATGCTGAAATTATGTCCATCATCACTACCT
GGGCTGAGAAGCATTCGCCTGGCAACGAAGATGCCGTTATGGACCTGTTCAAGGACATTTCGCGGAAGTTTGGCATGGGGGAGATGACTGCCGATGACTT
TTGTGACCAGGTGCGACAGTGTGTTGGGTCGAAGTGTGCAAGCAAAATCATCCCGAACTCTGCAAAGCTCTTATCCGACGAGGAAAAGCAGAATATGATG
TTGGAGGCCTTTGCGCGTTTCAAGGAGCAAGTCAAGAAAGAAAAAGAGTCGAAGAAACAGCAGCGCAATTCACTCGTTTCCCCACCATCTGAAGGGCGTG
AGAGAGCTGGATCCTCTTCGGCAGGTCGTAGGCGCAACAAGGTGGTGGTCCCGCTCCCAATAAAGGATATCGAGCCTGTGGTCGGAGAAGAGGCGCAGTT
ACTCCACAAATCCATCTTGGAGTCGGTGCTGGCAGCATTTGGCGGCGACCCGAAGAAGATGAAGTCGTTCACGTCCCATACCCGCAAGTACGGCAACGAG
CAGATCACGGCGCACGAGTTTTACCAGTATTTAATGGATTCCTTCGACCCCGACTTCGTTGGTCGTTTGGTGCCAGACCTCGCGCGTCTCCTACAGGATT
CGGAGAAGCGGCATGCGCTTATCCGCGCATTGTGTGAGAGCGCACCTGGCTGGGCAAAGTTTGCGGG