Description :
From Genome Similarity Track
Location :
Scaffold_883:2695- 4316
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_883-fgenesh-gene-0.0Conserved gene of unknown function

Sequence
1621 bases(100 bases per row)
CAGCCCCAGAGCTCCAAACACTTGCAGCGCGTGGAGCAAGAGGACGACGTGTTTGACGACGAGAGCGTGGATGGCGACGCGACGCCGACTGCCACAACCA
GAAAGTCGCCACTGTCCTCACCATCGCCACTACGACCATGGTACGGGACTTCCAGTAGCCCTGGGAACCCGCACGGTGTCACGATGGACGCCAAGGTGCG
TCGCTACGGCGCGTTTGGTGTCGTCAAGATGATGGCCAGCGAGACGCCAACGGCTGTGTCGCCGCCGTACAAGCTGAGCGTCTCGCAGTCGCTGGACTCG
CTCGGTCCACGCAACCTGCCGAACGCGTGGTCATCGCCCATCAAAGGCACCCCAACACTCTGGCCTGAAGGCGCGACGTACCCGAACGGGTCCAAACTGC
AGACCAGGATGGTTCGATGCCCTTCTCCTGTCGCGCGCATCCCAACAAATGCAGTCGGCGACATCCCCGCCGACGACCACCTTGAGAGAGCCAAAGTCGT
TCATCGACGAGATGTCAAGGAGCTCGAACAGAGGTTCGACGACGAGAAGGTGCGGCGCAAGCAGGAGATCGAGGCCAACCGCGCAGAACTCACATCGTGG
CAGCAATCGCTGGACTTTGAACCCCTCTCCAGCAAGATGGATCACCCGATCGTGCGGATCAAGGGCAAGCGCGCCATGCACCAGATGACGATCCTGCACA
CGCCAGAGTACTCGCACGACTCGCAGTTCAACGAGCAGGTGCAAAAGATGACGGAGAACAAGTTTGCGCTGCGTTGGAGCAACATGGCGGTCGTGCTCGA
GGTGATGCGGCGCACGCCGTGCCGTCGTCCCGTGCTCCAGGACGTCGAGAAGCTCTTTTCGATCGCGTACGAGCTGGCGTTCAAGAACATCACACCGACG
GCGCTCAGTCGCCAACAGTTCTGGTCGCTGATGCAAAAGGAGTACCCGGACGTGGAGGCTGGCCACGCAAACCGCTTGTTCTCGTCGTACGACTTTAGAA
TGCAGGACAAACTCGACATCCGCGCCTTCCTCGGCACCATCCGCGCGCTGAAAGTGCAGCAAGGGTCGCCAATCGACATGCTCTGCATGTCCTTCCGCGA
CTTTGACGCCACCAAGACGGGAGTCATCTCGAGTCTGGAAGACTTTGTCAACGCAACCACAATTTGCTGTGGAGATGACGCGGATGAACGACGTGTGACG
ACCCGAGCGACCTGCGTGTGGAACGACATGAAGGCAGAAGTGAAATCTCGAGTGCAGTGGCACCGGCGACCCCAGCAAGACGACAGTTTGGCGTCGGTCC
GGAGCGACTACGAGGACCTCAAGGCTGACGAGCTGGAGACGGAGCTCCGACTGATGGCCGAAGGGCGTGTGTCCATTCGACACGCTCGCACCGCGCTGCA
GCGCGAGAAGAAGCTCCTCCAGTTGTATACGGACCTGCTGCTCAAGCGGCGAGAAGAGTGTTTCAATGTGGTCATCCCTGCAGCTCGGCAGGTTGGAGGC
TAGATTTCATTGTTCAGATGGACCACCAGTGCTAGCGCGACAATCATCACCAGCCGATTTGCACGAACGCAGCTTTGGTAGTTGCAAGTTGCGGGTTGAG
GAGGTGAGTCTCTGTCCGATC