Description :
From Genome Similarity Track
Location :
Scaffold_242:26943- 28768
Transcript NameFunction/comments
Phypl_g5830hypothetical protein

Sequence
1825 bases(100 bases per row)
CACCGGAAGGAGCGGGGACGGAGACGGGCAATGCAATGGCGACCGACCAAGTAGAGACAGGACGTGGaggcatcagcagcaacaccacaGGGAAACCTGA
GAACGGCAGTTAATTGAGAGCGACAGAAGACTACCGAATAACGCATGTGAACCCAGCGGTGGATGCAGGAGCCCCACTATCCACCTGGCTAGCGATACTA
GGAGTCGTGACAATTGATGTGGCGGCAAATGGCCATTGTGGCTGGCTAGCATACTAGGTAGCAACGTACAACGCTACGGAGGGGCTCACAATCCCATCCC
GGGAGGTTGCGGCGGAGGCGTATGAACTGAATATCATGGTGGCCAACTTGGGAAACGAGGACCTCGTGAATAGGCAGGGTCTCAAGATGGAGGCACAAGC
GATCGGATGCAGTCCAGATAATGATGACTCACTGACAGAAAAATTATGCGCGCTCGCAAATCACCATGTGGAGCAAAGACCAAGATAGTGAGAACGGAAG
TTGCGCTACGCTTCTGGGTCAGGCCGGCGCACCTGAAAGCCATGGCGATGCACGCCAGAGAAACAATCTATGTGCTGGATGTGCCGGAAGAAGGCCCAGT
CCGAATGCAAGCTTACGCGTACCACGGGGTGGAGAGCGTAGTGAGCGAAGCACTTGAAACAGGAACTGTCACGCCGTTAGCGACACCAGCCGTTATCAGC
ATCTTACAGGAATTGGTGGCTGCAGGAATCCTCCCGATGGTACTGGTGCTCAAGTACGCAGCAGGGAATCACTTCCAAGTGGTATCTTATGACCCAGAGC
GCTATGCGTGCTACGCCCAAAATTCAGTCCAATTGATTCAAACACGCAACGACATATTGCGAAAATATGGCTGCAAACCCGCTAGATGCGATCCCATATG
ATATGCAAGACCTAGCCAAGGCAGCGGCGATGGAGCTTAAACATCACAGAAGGGCGAACAAGAAACGACAGCACACGGAGGGCACGACTATGGCGCACCA
AGAGGGGGGAACCAGCGacacggagaagaagggcagCAAAAGGGCGGCGGACATGCGGCAGGACGATGACCAGGAGACTACGGAGGACCAGCCGACAACG
GCTAGCGAAATGACGATGCGATAGAACACACACAGGCAGAGGAGAGCAACGAGGTGGCCATGTGCAGGGATGCAGTACAGCAGGCGATAGGCGGCGGCAA
ACAGAGAGGAGAGCAGCATCCCGGGCCGACGGGGGTGTCGATCAAGGACCACCTGCTCGAAGaggcagcacgcgcggcCGAAATGGACAAAGGAAATGCG
TGGGTAGGGAGGACTGGGGCAGCAAGGGCCACGCGGCTACAAGTGACGAAGACAACTCGGTAAAGGGACATGCACCTACAGAGGGTCAATGAGGGCCTGA
CAAGGGGGGGTGGTCAGCGAGAAGGAAGTgagagaggaggaggcgcatCGAACAAGGGGCCGGCAAAGCACAAGGCCAGCTGATCCGATAATGATGGTGC
AGGAAAGGGAGGAGATAACGAGATGGGAGCAGACGGACACTAGCACTACTGCGACAGCAGACAATCCAGGGAACACGGGAACACTCGCAAGAGACACGGA
AAGGAGTCAGGACAAGTCGGACGCAGTGAGGCGGCAGCTAACTCTACCTGAATTCTTCCAGaagcagacggaggaggaaaaCTATGGGGCAATAAGGAAA
GATCTCCGGTCACACGGCAGATGGCTCCGGAGACAGAGGAACGAGGCAAAAAGAAAGTCAGCGGCAGCAAACGTTGACACTCACAAGAACAACAGAGCGC
TGGGAATTACGTCGCTAAACATTCG