Description :
From Genome Similarity Track
Location :
contig_184:26942- 29959
Transcript NameFunction/comments
g11958.t1hypothetical protein

Sequence
3017 bases(100 bases per row)
CTTTTCCACGCCGAACTTCTCCGCGAGTCGTTGAATATACGCTCGCTGATTCATGACGATGGTCTTGTCGTCGCGGTTGCGGTGGATCTCGATGCCGAGA
CAGTACTTCAGCTCACCGAGCTCCTTGATGCTGAACTCGCGCTTCAGCGCCTTCTTGATCTCACCGATCTCCGCTTTCGTCCTGCTGAAGATCATGAGGT
CGTCCACGTAGACGATAATGATGCTGAACTTCGAGTCCGAACGCCGAACATACACACACGGATCCGCCGCTGACCGATGGAAACCTTGGCCCTCCAGGTG
CTTGTTCAGCTTGCTGTTCCATTGGCGTGCCGCTTGCTTCGTGCCGTAAAGCGCTTGCATCAACAGGCACTTCTTGGTTGGGTTGACTTGGTCTTCAAAT
CCGTCCGGCTGGTCCATATAGAGCTCCTCTTCAACGTCGCCGTAGAGAAACGCGGTGTCCACATCCACATTTTCAGCCTCCATGTCTTCCTCTGCTGCAA
TCGCCACCGCCGTGTTGATGGACTCCTTGCGTGCTACAGGAGCGAAAGTCTCCGTGTAGTCGACCCCTGGACGTTGCGTGAAGCCCTTCGCCACGAGACG
AGCCTTGAACTTGATGATCTTCCCGCTCGGGTCACGCTTGATACGGAACACCCACTTGCACCCGATCGCCTTCTTGTCTGACGGCATGTCCACCAACTTC
CAGGTGCGGTGATCCTCAAGCGACTTCATTTCGCTTTCCATGGCGCGCAGCCATTCGTCCTTGTACTTGCTCCGCATGACTTCATCGTACGACACCGCGC
GCTCACCGTCGTCGTCTTCGGTGAGGAAGCAGTAGAGGGAATCGAACTCAGCCTCGTAGTCGTCCAGGTTGAACTCACCCCTTCGAGTCCCGGGAAATTC
GTCTTGGTAGCGCACGACTCCACGCCTTTTGCGTGCCGGACGCACCATCCACTCCTCTTCGCCGTCTCTCCCTGGCGTGCTAGAGCCACGCGTTGGCACA
GATCCGGTCGGTCCGCTGTGCTCCTCGGGTTCGTGGAGTGGGCGTGTCGGGGGCGTGCTGAAACCGTCGTCAACACTGGGTTCTTCGGTGCGCTCCTCTT
CTTCATCGTTGTCGATGATGTCGATCACCTCCTGGTTGCGCGTCTTCGCCATTGTGACCGGTGGCGCTTCAGCAAACGTCACACTCCTTGAAATCACGAT
CGATCCGTCGCTGGGGTCCAGGAGTCGATATGCTTTGTGTTGCTTGGCGTAGCCGAGAAACACGCACTTGATCCCCGAGTTGTCCAGCTTTTTGCGTTTC
TGCTTGGTCACATGGGCGTAGCACTCGGTCCCAAAAACGCGCATGTGCTCCAGACGTGGCGCCCTCTTGAAAACCAGCTGGAATGGGCTTGCGTGTGGGC
TTGACGTGTTAGGCAACACGTTCCGAATGTCTGCAGCTGTCATGATGGCCTCGCACCAGTACGACTTGTCCATCCCGCTCTCCCCAGCATGCAGCGTGTC
ATTTCGACCAGCGTACGGTTCATCCGCTCTGCCATGCCGTTCTGTTGCGGGTTGTAAGGCACCGTGAACTCTTGCTTGATGGTCTTCTCGTCGCACAGAG
CCACCATCCCCGCGTTGCAGTATTCACCGCCGTTGTCACTGCGTAGCACCTTGACCTTGATGCCCGCACTTGTTTCTGCCTCCTTGAGAAACTTCTTGAA
CGCCTCACACACTTCGCTCTTCTTGCGCAGTGGGTAGATTGTCACAAAGCGACTCTTCATCATGATGAAGCTCACAATGTACTTGTAGCCCGACTTGGAT
GCAGGAGTGACGGGCCCCAACACATCAGAGCACACAGTGGTGTCCTTGCGTGCGCTCTCCCTGGCTTCGAGTCCCTCCTTGGTCGACTTGAAAGGCTTGC
GTGCCTGCTTCGCAGTCGCACACACGCCACACACGGTTCCAGGCTCTGCCAGCGCACCCTTGAGTTTCCCGTCCTTGATCATGGAGTTCAGCGTGCCGAA
AGACGCGTGGCCGAGTCGCCGGTGCCACAAATCCATATTGTCTTCAGCCGCATGGCACTCGTCGCCGCCCTCAATGTTGAGGAACATCAGCTTGCCTTGC
TTCCTGCCCGTCGCCACCACTTGGCCGCCGCGTTTCACAACGCACTGCTCGCTGTCCATAGTCACGGTCATGCCGCGTGCCGTTGCAGCCGTGAGAGAGA
ACAGGTTCTTGTTCAAATCTTGAACGTGCAGTGTGTTTTCCAGTCGCGCGTTTATCCACGCACTACCAGTCCAGACACGCAGAACAACTGTTCCAACCCC
GAGAATCTTCAAGCTCGCGCTGCTCTTTGCGCTCGATATGGTGCGCGCAGTCTTTACACCCGAGTACTCTTGAAACGCGTCGCGTGTCTTGCACATGTGT
GCCGAAGCACCGCTGTCCATCACCCAGCACTCGCTAGCAAAAGCTTCCGTCGCATGGAACGCAACGTTCGACTGGTCTTGGACATCTTCATCGGGACTTG
CCTCGGAACGGCAATCCCTCGCATAGTGGCCAGGCTTGCCACAGTTGAAACACTTCCCGAAGGGCCCCTTCTTGCGCATCCCGCGTGCGTTCTTCTTCTT
CTGCTGCTGCTTCCCATTGCCCTTGCCGGCAAGAAGCGCAGTCGCCTCTTCGATGCGGTTCGAGTCCTTCTGACGCACTTCTTCCGCAATCAGCTTGCTC
ACCAGGTCTGCAAGCTTGAACTCACTCACTGACATGCGAAACGCTTGAACCAGAGCCTCGTAGCTCGATGGCAGACTCCGCAGCATCGTCGCGCAGACGT
CTTCCTCAGTTGGCTCACACCCCGCGTTCTTCATCTCCATCACGAGCTTCTCCAACTCCGTCACGTGCTTGCCGACGGAGGACGCCGTGAACTTGAACGC
CGAGAACTTTTCCTTGAGCCACAGCCGGTTCGCCATGTCTTGAGTCTTGTGGAACTTCTTCAACGTGTCCCACGCCTCCTTCGCAGTCGTGGACGTCACC
ACGTGCATCAACTGCGA