Description :
From Genome Similarity Track
Location :
Scaffold_168:2694- 4021
Sequence
1327 bases(100 bases per row)
TCGTCATCAATCTCCATCGAAAGGCCAGGCGAAGACACGCTTGATACATCAGTCGTGGGAACAGTCGGAGCCGACTTCGAAGACGCGGAAGCTAGTGGAG
CAGCCTCAACAGGGGCAGACCCTGCTGTAGAAACCACTCCCGAGACTTCAACTGCCTTGGATGTCGCGGCAGACGCCGAAGCAGACTTGCCTTGTGGGAC
AGTCTGGTCTGACTCTTCACCTTCTTCACTCGAGCCAAACATGAGCCGCATTTCCTCGGCCTCGCGCAGAGCCTCTTCAGCAGCACGTATGTCGGCTGGA
GAAGGTGAAATCGTTGAAGCTGGTGACTTGGCCACATCGTGTGGACCCTGAGGCGGGGGCGAAGGCGCGTCAGGAGAGACAGGAACATCGTCGTGATCCT
CAGGGTTCACGTCCTTACCCGAAGGCTCTGTAGCAGTTTCTTGAACCGAAGGGACGCTGCCTGGATCAGCAGTCCCCATGTCCACGTCACTCTGGTCGCC
GCTGAGGTCGACCACTGCGGGAGTCGAGGAAGACGCTGGTGTAGGAGGTGGCGACCATGAACTTGGAGAAGACGGTACAGCCTTGGACCGAGTCTTCATA
TGACGTCGTGGCGACTTAGCAGGAGAATGAGGACGGGGTTTCTTGCGCTTCTTCTGGGCCGCCTTCTTCCACGCCTTCGGACCGAACAGCGATCTACGAG
CCGACTTGGGAGTTGAAGTATCGGCAGGTGGCGCATCACCGAGACCGGCAGCTGCCATCGAAGCACTGGCCTTGTCCGTTGGGATTGGAGCCTTGTCTTC
GTCAGAGTCGTCCGGATCGTCATCTGAATCCTCGCCACCTGGTCTAAGACGCTTATGGGACTTCCCATGGGCCACTTGGTGAGCTGCTTTGGCCAAAGCT
GCCGGAAAGGCTTGAGGATTGTCCGAAGAAGCGGTGGCAGACTGAATACACCGCAGAGCGACTAACGTCTCCTGATCCAAGTCCAGCGCATCCAGGTCCA
GCTCACCCGCAGTCAGACCTATCACGAAGGATTGTGAACGAACGTTAGTTGCTGAACACACGGTGGAAGGAGCAACATTAAGAGCGTACCTTCGACAGCC
AGACGAAGTACCTCGGGATCCATTCCTGCCAGACTCACGTGTGCACGGAGGGTACGATTCGCTTGGAGGAGGCGAGTGTTACGGTCTTGCTGGTTCTCGA
GGACCTTGAGCGTGTCGTTATCGACATACTTGCCCTGGGCAAGCTTTACCAGAAGGAGGTGGAGCTTCCGGGTCTGCTCAGTATTCGCGCCAATAGAAGA
CTTGTACACTTCGCGTTCGCGAGCCAG