Description :
From Genome Similarity Track
Location :
Scaffold_691:2694- 3995
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_691-fgenesh-gene-0.3CAAX prenyl protease 1

Sequence
1301 bases(100 bases per row)
CCGAGTCGTTCATGCAGCGACCGAACACGAAGAAGAGCGCGAGCGTGTAGAGTTGCTGGATGACGAAGCCCTGCGCCGTGTGCCACAGCTGCCAGTGGCC
GAGTTCGTGGCCGAGCACTGCGACGATCTCGTCGTCCGTCGCCTGCTCGAGCAGCGTGTCGTACAGCACGATGCGCTTCGACTTGAAAAAGCCGAAGAAG
TACGCGTTGCTGTGGCTCGAGCGCTTGGAGCCGTCGCACACGAACAGCTTGGTGAGCGGGAAGTGCAGGCGAGCGGCGAGCGCCTCGATGCGAGTGCGGA
GCTCGCCGGCCTCGAGCGGCGTGAACTTGTTGAAGAGCGGCATGATGAGCACTGGGTAGAGCGTCACCATGATGAGCGAGAAGGCCAGCAGCAGCACCCA
CACATACAGGTAGAAGAGCTCGCCTCCCCACCGCACGACCACGATGAGCGCGGCAATGAGCGGGTAGCCGATGGCGACGAACAGCGCGAGACCCTTGATC
TTATCGAGGAAAAAGAGTCCGAGCGTCTGCTTGTTGAAGCCGTGGCGCGCCTCGATCACGAACGTCGAGTAGAGCGAGAACGGCAGACCCACTAGTGTGT
CGCGAATCGTCGTGAGCGTGAGCAGCATGAGCGCGCGCGAGATCTCGTTGGTCGCGTCCAGGCCGAGCAGCGCCAGCGTCTGGCCGCTCAGCGTCCACAT
GAACGGGAGGTAGCCCACCAGCAGCAGCGCTGTGGCCTCCACCTGGTTGTAGGCGCCTTGCAGCAGTCCGAACGAGCTCTTGTCGAGGCCGTAGGCACGA
CTCTGGTCGAACTTGGCGCGCGTGGCATCGAGCAGCGACACGTGCTCGGCATCGGTCTTGTCCTTGGGTTCGTCCTTCTTCACATCCTCGTCCTTCTTCT
CATCCTTGTCCTCCTCTTCCTTCTTCTCGTCCTTCGCCTTCGGCTTGTAGCTGCCGAGGTTGCGCAGCGCCTCCTCCAGCGGCGGTGGGAACGCCGTGTC
CTTGAGCTTGCGGTGTTGGCTGCGACACCGCCAAGCATTGTTAGATACCGAGAGCAACAATCATCAACGACCGCAACTCGCACCGGAGGTCGAGGTAGGT
CTCGAATACGTAGACGAGCGTGAGGAACGCAAGACAGGCCGCAAAGTACGGGACAGCGGGGGCTCGCCAGCCGTCCTCGCGGTAGTACGGCGCCTGCCAC
CACGACACGTCCGTCGCCTCCATGCTGCCGCCTTCTTTGATGCCCAAATGCGATCGATTTGCCACGTCAAATAGCAATGTCACTACCGAACTGACCTCGA
C