Description :
From Genome Similarity Track
Location :
scaffold_356:26934- 29575
Transcript NameFunction/comments
g7602.t1 bifunctional aspartokinase/homoserine dehydrogenase, putative

Sequence
2641 bases(100 bases per row)
CGCGTGCGCCGCAATTCCGTGCCAGGAACAGCGTGCTGCCGAAAAGCGAGCCTGCCGTGATCGAGCAGTCTGCAATGGGGCCCGTAACCACCACGGGGTG
CAGCGAATGCCGCAGCGTGTAGAAGGCAAAGCCACCCTGACGGCCCTTTAGTGAAGCAAAGGAGTGCGTCGGGGGCAAAGCCTCCACCCGGACGGAGATC
TTGCCCGTAGCGGCGTCGATGTAGCTCATCTGGCGCAGCTGCAGCGCCTGCTTGGGGTCCGCAGCAGCCTTCGCGATCTGTTCCTTCAGCGGGGTACTCG
CTTTCACGAGGTGCTCGAGCAAGTAGTCGTAGCTCCAGGCGCCGACCTCGTCCTGACTGCCGGCAACTGTAGCGCTGGGGTCCCACGGGCTCTCGATGTT
GGCGTCCTTCAGCTCGATGTCGTAGCCCATTTCGCGAGCGATCATGATCGCCTTCTTGGCGCTGCGTACACCCATGACGTCGTCCACGATGTCACGCACG
CTGAACTCGTTCTTGTACTCCGCCATGAGGTCCTTCATGATCGCCTCCAGGTTAGCCTTGGCCGGCTCAGGAAGGGCAAACACAGTGTCGAACATGGCGT
GCAAGAAGCGGCTTCCTGAGTACTCGACGCGCTGGATGTCGTCGCCCGTCTGGATGAAGTTTTGGATCGTGTTGAAAATGGGCACACCGATGGCCAGCGT
AGCCTCCGGGTCGTATGTGAGCTCGTTCTGAATGGCCATCTCCTGCATCGCGTTGTGCAGCTCCGTCGAGGCCGACGACACGTTGATGTTAGACGTCATC
ACGTGCACCTTACGAGCTAACCACTGCGGATACAGGTCCTTCACGTGGTGAAAGCTGTTCGAAACGTCGATAATGAGCCAGTGAGGAAGGTGGTCCGCGC
ACACGTGATCCAGGAATTTGTTGCGGTTGAACGGCACGAACTCGTTCTTTCGGCTAGCCAAAGCCTCCTCCGTAATGTCGCCGTCAACATCCAGAAGCAT
CTGCGAGGAAATGTGAGTGCCGATAGCGCGCACACGGATATCCACGTTGAAACGCTGCTTCAGGAACTCGCGCTGCTGGTGATACTGCTTCAGCAGAGCG
ACTCCAATGCTGTTGGTCTCGTCCTCTTCGAACTCGAGGCCCATGAGACCGATGGAAAGCGTCTGGTCCGACAGGAAGAACGAAGAGTGCACGGCGCGCA
GAGCAGCAGCCGAGTCCTTGTAGTGAACCACAGCGGAAATGTTGCGCTCGGACGATCCCTGAGAGATAGCCAGCACATTGATCTTCGCGCGGCCGAGTGC
ACCGAAGAAGCGGGCGCACACACCCGGAGTCTGGTTCATCTGGTCGCCCACAGCAGCAATGATACTGATCGGCGCAATGTACTCCGCCTTGTCAATGTGT
CCGACGTGGATCTCCTTGAAGAACGTCTCGTTGATCACGTCCTTCGCCACCTCAGCGCAGTCCATCGGCACCGCGAAACAGATCGAGTGCTCCGAGCTGG
CCTGGGCAATCAGCACGACGTTCACCTTTACGCGGTCCAACGCGCTGAATAGCCGAGACGACGTGCCGTGCACACCCACCATGCCGCTGCCTTCAATGTT
AAACAGCGCTAAGTCATCGACGGTTGAGAATCCGCTCACGATGTTGCGCGCCGTGGGGGTGCCGTTCGACATAGTGCGCTTGAGCTCAACTTTCTTGCGG
TCCCAGATCTTCGTGCCTGGGTGTTCCGGCTCGAACGTGTTGCGAATGTAGATGGGAATGCCCTCGACAATAGCAGGTGCCATAGTTTTCGGGTGGATGA
CCTTAGCGCCAAAGTACGCGAGCTCCATGGCCTCCTGGTACGAGATCTCGGGCAGGATCTGCGACTCAGGCACACGACGAGGGTCAGCGCTCAGCACACC
GCTCACATCCGTCCAAATGGTCACACTGTTGGCATGCAGCACGCTACCGCAGATGGAGGCGGTGAAGTCGCTGCCGTCACGTTTAAGCGTGGTCATGACG
CCCTCGACTGTGCTGCAAATGAAACCAGTGACAACTAAGTGCGTGAGCTTGTCGCCCCCTTCATTCTCCAGGATTGCGTTCATCTTCTGCTCGGACAGAT
CGTACTGCACCACCGGTCCGTGTTCATTGTCAGCCTCAACCGTCAGGAAGTCGCGGGCGTCCACAAAGCGGAAGGTGTGCTTCTTGCCGTCTTGCTGCAC
CTTCTCGCTGAGCACAGCTGTGAGGATCTTAGCCGACCAGATCTCGCCGTGACCGGAGATAAACTCCACTACGTTGTCGTTGTAGGCCTGCATGATGGAG
ATGGATCGCAACAGCTCCGAGACGGACTGGAGATCCCGCGCAATAGCCTTTTCAATGGGCTCTCCCACCTCCGGGGGCAACAACGCGCTCACAACATCGT
GGTGCTTCTTGCGTAGAGTGTCCAGGATCTCGTCGCACTCGGTGGTGCAGCGCTGCTTGGCCAGCTCGAGCAGCGAGATGAGCAGGTCGGTCACCTTGGG
CTTGCCACCAATAGCGGACACCACTACGGCCACGCGCGGGGCCTCAATCGCCGACACAATGTCCGCCACCTTGGCGAAGCAGTCGGCGCTGCCCACGGAC
GTGCCGCCGAACTTGTGCACCACGAATTTGTCAGCCATTCT