Description :
From Genome Similarity Track
Location :
Scaffold_57:269324- 270381
Transcript NameFunction/comments
Hyaar_Emoy2806948predicted protein
Hyaar_Emoy2806949Chromaffin granule amine transporter

Sequence
1057 bases(100 bases per row)
CGCCGACACGACATAATGCAGCACGACGAAGTGATCTGGGGCGTCATCTCCAAGCAGTTCTGCTCGTTCAAGAGCAAGTACGTGGCACCACCAAGTCCAA
TTGATTGCATCCAATTCGTAACCACCAACCAATGGACTTACCTTGTGCTACAGACTCACTTACGATGTGTCTTTGTGTGTCTATTACTCGCCTTGTACTA
CAGACTGCCAGGTACAGGTAACATGTTCTGCAGTAACCCGTACAACGTGACGGGTCTGTGCAATCGGACGGCGTGTCCATTGGCCAATAGTCGCTACGCC
ACGATCCGCGAGGAGAACGGCGTGTGTTTTCTCTACATGAAGACGATCGAGCGTGCGCATACGCCGAATCGTTTGTGGGAGCGCGTCAAGCTCAGTAGGA
ACTACACCAAGTCACTGGCACAGATTGACGAGCAGCTGCAGTTCTGGCCCAAGAAACTCGTGCACAAGAACAAGCAGCGACTGACGAAGATTCATCAGTA
TTTGATGCGGATGCGCAAGCTCACGCTCAAGACGAAGCCGAAACTAGTGGTGACTAACAAGAAGATTGAGCGTCGTGAGAAGCGTCGAGAGAAGAAGGCG
ATGGTGGCTGCCAAGCTTGACAACTCGATTGAAAAAGAGCTGCTCGAGCGGCTGCAAAAGGGCACGTATGGTGATATTTACAACTTTCCTGAACGTGAGT
TTTCCAAGGTGCTCGAGAGCAAGGGCAAGCGTCAGACAATGGAGGAAGAAAGCGAAGACGAAGACGAGGTCGAGTACGAGCTTGATGGCGACGATGATGA
AACTGAGGACGAGGACGTTGGCCAGGTTGAGTACGTGGAGGATTTCGAGGAAGATGAGAGCGATCTCGAGGATCTGGCCGACGAGTTTGCCGTCGACGAC
GACGGAGAGAGTGACGCTACCGACAGCGAAGATGAAGACGCATCGAAGAGCAAGAAGCGCAAGACAATTGCGACGTCAAAGAAGGCGGACAAGAAGCAGA
AGAAGGCCAGTGGCCCGTATGTTGAGATTGAGTACGAACAGGAGCAGGAGACGGCCA