Description :
From Genome Similarity Track
Location :
Scaffold_29:269312- 272054
Sequence
2742 bases(100 bases per row)
CTCGACTTTGCAAATGGCACTACGGAGCACACGACGGTTAGTGGCTCTGTCCTACTGCGAGTGATCAACCAAGCAACTGGTGAACTTGAGGATCGTCTGC
TGGACGATGTAGTCTACACACCAAACGCCAAGGTCAACCTGATCAGTATGGGATATCTTCAGACTACAGGAAACTACAAGCTGATGTGCTTAATGGACCA
GAAGATGGCGTGGATGTCGAAACCGGGCACTATCCTAAAGTTTGAGATGCGGGACAATCTCTACCGGCTGCGGAGTGAAAAGGCAACCGGGTGATGGTCA
TGGCCATGGCTAAGCAAGATGTAGAGGACAAGAAGACGATGGAGCTCCTGCATCAGCGCTTTGGCCATCTACACATGGCTTTGCTTCAGGTGATGGCTGA
TAAGATGGACTTGGGGGTAAAACTCAACACGAAAGATCTGAACACCTACGAATGCATTGCCTGTGTTGTGAGCAAGACAAAATCCATGAGTCACAAACGA
CTTCCAGTTCGCTCGACTAAACCACTTGAAACTCTGGCTATGGACATATGCACGATGAATGTGGAGACAGCAAGTAAAGCTACTATGTTCATGTTCATTG
TGGATGTTGCTACGAGATACAAGTGGGCCTATCTATTTAAGAAGCGTCAAGCTACCTGGTTCATTTTGAAGCTGCTAAAGGAGTTGCGGACGCATCACAA
AGATCACAGAGTGTTGCATCTTCGGTCGGACCAAGGTGGCGAATTCGCTGGAGCGGAACTGCATGAGTACTGCGTTGAACACGGTATCGTGCAGCAGTTC
ACGAACGCGTACTCTCCCCAAGAGAACGGGATCGCAGAAAGGGCGAACGGCATTGTACTGCCTCGTGTGCGAGCGCTGCTGACAGCAACACATTTACCGA
ACATGTTGTGGGGGGAAGCTTTGCTGCACATGGTAACAACACTAAACATGCTACCCACCAAGATGTTGGGAATGATTTCGTCGCACGAGAAGCTGTACGG
ACGGAAGCCGCCCTTGAGTATGTTGCGAGCCTGGGGCTGTATTGCACATGTACGAGTACCACCTGAGTCAAGACAAAGAAAGGAGAAGCTTGAACCACGG
GCACAAATGTGTCTATTGCTCGGTTACAGCGACTCTACGAAGGGCTACAAGTTTCTAGACCTATTGACCTGTCAGGTGAAGACTGCGCAGAGCGAGAATT
GCCGCTTTCAGGAGGAGTTCACAGTGGATGGAACCTACGTGAAGCAACTACTGGAGAATGCGTACCTGGACACACTGCACGTGTTGCCGGAGAAGCCACC
AGTAGTGAGAACTAAGACGAGTATCGAGACCTACACTACAGAGAATAGTGAGACTGTGCCGATGAGCAAGGCAGGTGAACTCCTAGAAGTTGAATGGGCT
GTGGACGGAGAACAAACGTCCAGTGGGAGTGCAGAGCATGATGACTCGTCGAGCATCGAACAGCAAGAAGTGGAGAAATCTGCTGATTCTCAGGTTGCAC
CTGAGAAGGGACCTGAACCAGTGAAGGTCACCAAGAGACGCAAGCGCAAGACGCGAAAGAAACCCGTGAAGGAAGATACTGGATTTGCAATCCAGGATCC
ACCAGTCGAGCCATATTTGAAGCGACCGAGAAGGACTCAGAAGGCAAACGTACGATTGAGCGACTACGTGGTAGGCCAAGTGATAGCGCATGGCATGGAC
GTGGACATTCCTACAACCTACAAGCAGGCACGGAAGAGGAAGTTCTGGACCTAGTGGCGGGCCGCGATGCTGGCAGAACTGGCATCGCTGAAGAAGCACA
AGACCTGGCGACTTGTACCGCGGAGAAAGGCGAAAGGTGTCAAGGTGATTACATGCCGATGGGTCTTTGCGGTGAAACGAGATGAGCGTGGACGTGTCAA
GCGGTTCAAAGCTCGTCTTGTAATCCACGGATTCAAGCAACAGTTTGGCATCAACTACAGTGAAACATATGCACCGGTGATTCGCTTTGAAACTATTCGT
GCGGCCATCTACTTCGCTGTGCAGCGAGGATGGGAGATACTCCAGTACGACGTAAAGACAGCGTTCCTGTACGGAGATCTCGACGAGATGATATACATGG
AGCAGCCGCCTGGATTTCAAATTGATGGACCAAGCGCTGTATGCGAACTATTGAAGAGCCTCTATGGATTGACACAGGCACCTAATGTTTGGAACCGGAC
TCTACATGCAAAGTTGGTGATATTGGGCTTTGAGCGCACAGACTCAGACTATGGCTTGTATGCGCTAAAGGAAGAGGGTGAAGCTAAGCTGCTATTGACT
GTCTACGTGGATGACCTACTACTAATGGGACCCCGAGACCTGTGCGTCAAGATTGCAGCTTCACTGCAAGAAACCTTTGAGCTGACTACGATGGGGACTG
TCAAGTACCTACTTGGTGTCGAGATACTGCTTGACAGACCAAGCAGACAGATTGTGTACTGTCAGAAACAATATGTGCTGGAAGTACTTAAGCGGTTCCA
CATGTCGGATTGCAACGGATGTACTACTCCTGAGGCTACTACACTGTCTAAGGCAACTGTACCTGCAACAACGGACTATCTACCGTACCGTGAGCTAGTG
GGAGCACTTCAGTACCTAGTGAATGCGTCAAGGCCTGACATTGCACATGCAACGAGACATCTTGGCAAGTTCCTGGCGTCCTACGATCATACACACTACG
CGCAAGCTAAGAGGGTACTTAAGTATCTAAAAGCTACGTGTG