Description :
From Genome Similarity Track
Location :
Scaffold_53:269294- 270813
Sequence
1519 bases(100 bases per row)
CAAAGCGAGCATAAAGGAGAAACTACGTTAGACTGCTTAACGCACGAGCTCACAAGCAACTTCCTACACAGCCGCCGCCCTGCAATCTCATGGCTTAAAG
GATTATCAAATGTCACAAGAAAATGTACCAAACAAATAAGTCGAGGTTGACCGGTAAAGTTGGTTACGGGGGGGTTGTAGGAGCAAATGGACTTGCATGA
TGTGATTAATAGTATGCGGAAGGTTCTAAGAGTAATCCGAGGACGATGAACGAAAAGGCTTTTGTCGCACGTGATTGCTTTAAGAAATGGCAGTCCGCTA
TCTATTTAACTAGGTTAAAGCTACGATATATGTACCTATGCTTGTCCGTCAAATATTGCTTTTGTATTTTAATATTGGTCGGTCTGGCGAATACGGAGCA
CGGCTGGATGGCGCTGAGACCCGAAGTTATCATTTGTTAGCTCTGAATCTTGCAATTTACCGTTGATTATCAGAGCAGGGCCCCGGTTTGATTTTTTTGC
ATAGCAAACTATGTTTCTTTAAATGTGGCTTGTAAAAAAGGTAAAAATGTTGTAATCATTTTGTTTAGCTAATAGTTTTTGGTTTTACCCTTGTTTTATT
CTTTCGTTTTTCATCACTGTTTACCTTCTATTGGCAGCATAGGTATGGTATTTATTGGTGCAGTTCGACTGGGTTAGGAGTTCTCCGCATACAATCACGT
AGTTTAGTACACTTTTCCAGCCCGTTCGTTGGATAAGGGCTCCTGATGCGTCCTTATAGTATTAAACACACAATGAACGCATTTGAATACTTTTATAATG
TTACAATTTGAATATTGTTTATCATTTATTGAGTTTATTATCAAAAGTGATAACGCTTTAGTTCAGTACAAGATCAAATTGGCAGTACAAGGGGGTACTT
AGTGCAAGCTGAACAGGCTATTACAATCATTTGCGCTGATGTGTTCTAAGCTTCATAGCACCGTGATATCGAGCACGACGCTAAACTAAATATATTGGGT
AGCCATGCTATTCGAAGCTTAGGTGCTGGGTGGAAGATGAAGATATCGTGATAGCCAATAATATTAATAAGACTCTGTAAAGATCACCAGAATAATATTT
TTTAAGCATGATAAGCGTTATGCTGGGGGCTTAGAAATAATTGCACGGCTTACTGGAAACTCAGCATTTTGTAGCGACTGGTCTAAATTAAACTGATTTG
GAAAATTAAAGAAGTCGATTGAGGCACATAAGGGCTCGGAGGTTTTGGAATAATTACACGACGAAGCGAAGCAGAGGCTTGAGAGCAAGCAACCAGATAA
AACCTAAAGTACCGCCGCGTAGCGACGGCGCTCGGCATGTGAAATATTAATGGCACAGGGAGGCAAGGCTATAGATAGATGATGCTTGTTCCAATGCGCA
GGTCAATGTGTACCTGCAATAGTGCTTCAGACTAACTAAAACAAGCGGACGCGAGCGCACAGTCACGATTAACTAAGGCGAGCGGGGTGCTCACGAAACC
TGTCCGCGCGGTATTATCG