Description :
From Genome Similarity Track
Location :
Scaffold_696:2692- 7315
Transcript NameFunction/comments
g14887.t1hypothetical protein
g14888.t1hypothetical protein

Sequence
4623 bases(100 bases per row)
CAGTAGTGATTGAAGCGGAGCCTGTGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGA
CTCCAATAGTAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCATATGTGATCTTGAGCTTCA
GCTCATGATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACG
AAGGTGTTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCACCAATTGTTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACT
TCGTCCAGCAGGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACTGCATAATCTGGTCGACGCGAAAGCGCGT
CGGCCACGACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGA
CTTGATCGCCGTACGCAACGATGCGTGGTCGGTGTAGAACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTAGCGAGTGCATACTTCATGGC
AAGGAGTTCCTTGTCATGCACCGGGTAGTTGCTCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGC
ATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCTTCAGTCAAGCCCT
GCTTGACTGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTT
GCTCACGTACTTACACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCT
GGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGACCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCT
TTCGCATGAGCTCAAGCAACTTGCGGATATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATA
GCTCGGTGCGAAGTCGCGTACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCCCGAGCCACTCC
CAGAGCATGCCGCTCGGAGTGCTTACCGCCGTGAGAGGGATATCCCTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGA
TAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTATACGCATGAACGAT
GCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGAACTTTCAAAGAAGGCGTCGATTGCCTTGACTTGCTCACGCGGCAGTG
GCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTATCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAG
TACATCCTTGTACTCACGCAAGACCTTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAG
GGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCG
TGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTCGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATCCAGCCTCATCTTCTTGTATTGGA
GACCAATATTCGTACGCGTCAACACACTCAGTGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTCCCTGA
CCGAGGTTTGCGCAACTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGGCCGTGGACAGTTGT
TCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCACACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCATCCGTCCGCACTGCTTGCAGCATCG
GCTCTCAGAGCCGACGCGTCTTTCTTACCTCTACGCTTAACGGCGGAGTGTCTTTTGACAAATGTGTGTCGACATTATCTGTCGACACGACCGCGTCGCT
CCGGACGCTTCGAGACCCTCTCCTATCCGATTGAATCAGGCCCTGCTGATTCGGTTCACATTTCCATCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTG
GGGTGATCGGAGACAGCCGCATTCCGCGCTGTCTCTGATAGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCACCGACAGGGCCATCGCTCTCTTTCG
CGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCTAGTCGATCACCGGATTATGCCGTGCAAGCCACGGCATACCCAACACCATATCGACGAA
CTCCTTCTCTTGATAAGAGAAGCGTACGCGTACAATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGTCTCACTTCCAATAGACTTCGAGGTGTT
TCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCG
AGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGAT
GTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTCTAGTGTTTTATAGTCCGTGATGATACCCAGTATCGCCACGACGGCT
CTTCGCCGCGTGCACAGGTGCTGGGCACTCGCGAGCGTAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAA
CCAGCAGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCAGGCGTGGGGCGTTCACATGCAGTTTAG
CCTGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCT
AAGACCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCCCTTTCGGCGTAAGCATGCACG
TCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAAATCCTCGT
ACGTGCTAAAGCAGGATCCGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCG
ACGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAACTGCTTACGTGGAGTTTCAATG
ACTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAACAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGT
CGGTGATAGCGTTCGCAACATCGTTGCTATCGCCGCTTCCCCAATGACTGTCGACAGTCGTTGGAGAGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAG
TCTGCACGCGCAACTTGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAA
CGTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGATGTAGTGGGTCCGCTTAGACCCACTACTTAAGCTTACACTTGTGCGCACGTGTATGAG
GAAGCGTAGGAGTAATTTACTTAAGTTTAGTATACTTGTATCCGCAAGTATACTTAAACCTAGATAAATGAACCGAACGATAGCTTTGGTGCTGAATGAG
AACTGTATTGATTGTAAATGTGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGAC
TCTTATTGGTAGAAGGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCTTGTGGAGTGGTCACCTGAATGTATCCCTTAGTGC
ATGTTGCACTAAGGTAGGAGGTG