Description :
From Genome Similarity Track
Location :
Scaffold_337:2690- 3911
Sequence
1221 bases(100 bases per row)
TACTGCGGCAAGGGCGTGTCAATGACCAGCCGCTACTACCATGCGGCTCAGCGCCCCGACGAGACCCCTCTGGATTACTTGTACCGGCTCAACGTCGCGG
GCTTGAGGGCCAACATCCCATACGCCGAGGGCACGACTGAAGAGAAGCGCGAACACGTCGAGCATTTCATCCGGACGCTGAACACGCAGGAGGCCGAACT
CGCCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAGCTGCGTGCCCGACAACGTGGATTGGCTCACCAGAAAAAGACTCTC
TTCGGCTCGAACAAGTTCCGCCAAAAGGCGCCGACCCCGCCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCACGTTGCGTCGGACGAGTACGACTCGG
AACGCGAGAGTCGCGACAGCGACGATCGCCAGTACGATCAAGACGGGGAGGACGAAGAACGCGCCAATTTGTTCGTCGCGGGGCAGACCCCGCCGGGAGA
GCCGGCGCGTCGCAACTTCGATCCCGACGACTCGGGACGCGACCGCCCGCGGTGCCGCCACTGTGGTTCACGTCGCCATGCCGAAGGAGACTGCTGGAAG
TTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGTGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCCGGAGAATGCTCGA
TGGAGGAGTTCTTAAACCAATTGCGCCAGTGGTTTCACCCGAATAAACACGCGGGAATGCTGCCGCCGGCCGCCGAGAAGATGTTAAACTAGGACGCTCG
CTGGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAAGTGGTTAGTGAGAGCCCGACTTCCCTGA
ATGATAATACATGTGAATCCAACCTGGAACGTACCACGCAAGAACGCGCGCCGCGAATGTCGGCGGTCCGACGTACGACGGACGACGAGTTTGCACGTGA
ACCACCCCTGGACGAGATCGACTTGCAACCAGACGAGCGACGCGGATACTGGAAACATTACGCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCATGGA
AAGCTGAACAACCGCCGTGCTGTGTTATTGCTCGACACAGGTGCCGAGGTGTCCATCCTGGACACCACCTTTGCTCGTGAGGTAGGCTGCCTGATTGACA
CGGAGATCACGCAAGAGTGGG