Description :
From Genome Similarity Track
Location :
scaffold_4:2689457- 2690923
Transcript NameFunction/comments
Plaha_PHALS_09020phosphatidylserine synthase

Sequence
1466 bases(100 bases per row)
TCAATAAGCCCATTGAGACGCCAAGAAGGTCAGCGGGACAAACGAGGCCCAAAATAGTACGTCAAGATAATCCCAACGTGAAATCAAAGTAAAAGACCGT
CGTGAAGTTGGTTGGCGCTGCTTCTGACAAAAGAACAGCAGCATCCAGATTGAAAACATGACCATAAAGGCCAGAATCGGATACAGAACCAAAGACGGTG
GTGCCTTTGTAAATAGGACGCCGTTAGCTGAAAATTTCACCCACACCAGAACCTCAAATGTTGCAATCGATAATATCATCCATGCGTTCTGTCCAAGACG
CCAGCATTCCGGGTTTGTAATAAATTCGTAATACTACAATAGATACTGTCATCTCACCACAAACTGATCGAAAAACAAGCAGATCAAACGAGATATCTTA
CCTCAGCAGCTGCAGGAATTCCAAGCAAAAATACGAGTAACAAGCGATAGGAATTGAAGTTGCTCTCCTTTGGAATACTCAATGTTGTGAGCAAAAAGAA
CGCATTCATCTCCATCAACAGACACATGGCAAACGCGAAAACTATTTCTGCGAATCGACTAAAACTCGAAAATACCTCCCAATGATATTGTTCCCACCTC
AAGGGTGTAAACTGGTTCAAAGCTAAGCGAAAGTAGCCCATTTTCTTCCCTCGACGTCCCGACCAATCGTACTCTTTTGACTCAAGTAACCATAGCGTTA
TACGACCAAGACACATGCCGAGCATATTGGCACCCAATAAGTCCAACATAAGCGAATCCCACCTACAAAAACGTGAATTCGATTGAACAATTTCAACTTC
AGCTATCTTTTACAAGCTAATAGCGTACCAACACTCTTGAAAATCTGGTATAACGAACTGAAGTGCAAGCTCGAGGAATTCAAAGGCAATGCTGATCATC
CAACAAAATCGCCAATCGCGAAACATGCACATTTTCCCCCACCAGCCCGTTACATGTGCACAGAACCAAATGCTTGTCATTCCACGTGTTAATGACTATA
ATTTTAAGTACATTGTCAGCTTTTCTTCTCTGTATTAGCATTAAGAAACAAACCTCCGCATTAATTTTGCACTGCAATTGTGCAGAAATCGTCATCTTGG
GTCGACTTCCAACATCAGGAAATACATACTGCATGCCTTTAATTGCACTTTCTCGATTCTGCACAAGCATAGCTGCTAACAGCAGCAAATATACGACTGA
ACATCCATGCACTACTCGCCACAAACCTGGATGGGGTCGCATCATAAGACCATCTCTTGTCTGGAGAAAGCAGTAAACTAAAAAGATCCAAATGGCGGCG
AAGAGTGCGTTACGAACGTTCTGGATGGTGTCCTGTGATTCGTGAGTGAATGAATAGTATGAAAATGCTAATACAACCAGAAGCAGCACGAAGATTTGAC
GTGGTTGTTCTGGAAACAACAATAGTCCCTCGATCTCGTTGCCGTGTGTAGCACGAAATGTATTGT