Description :
From Genome Similarity Track
Location :
Scaffold_135:26891- 29470
Transcript NameFunction/comments
Albla_Nc14079610conserved hypothetical protein
Albla_Nc14079620

Sequence
2579 bases(100 bases per row)
TAATATTGAGGACTCAATAAAATCCATTCTGTCGACCGTCAACAGCTTCGCGTATCCGATGAGTTCTTGGCAGCAAAGCTATCACAAATGAGAGAAGTTC
TTCCTTTGTCGTCGATGCCAGTTCTGGTACTTTGTATACTAAAATGATCACTATCCTGCTCCATGATCGCGATATTCTTACGAGAGATGAGTGTTAGAAG
TCAGAAATCGAGTTTTTCACTGAATCAAAAGCGCTTCCAAAACCCCTGAACTCAGCTACTAGCTTTTCAAAGGCTTCAGAAATAGGTTCTAGGCGCGTTG
ATGAATTGGACTCAGAGAAGGTCGCACTGGAATTTCAGATTTCTCAACGAACGGAGATGGTAAGCATATTATGTTGTGCAGCACCGAGATAGCAGATATA
ATGTGGCTTTAGTTTCAAGATGTCTTATTACGGAGAAATGTCGGAATCCAGGTCTTGACTTGCCACTTTCAGTCTTGATCACAGCCTCAATGTTATGAAT
ATTGGTCTTAGGAAGAATACAAACGATCTCTGTGCGAATTGGATTTAGAATTGGATGGTTTGAATCAAGCGATCGAGAAAAAGCGACGGAAATATAAACG
TGTTCGGCCTTCGTCTTCTTTTAAAGTCAATGGAGTTGCTCAGGAAAAGCACAGAAATTTAAAAGAGACTCTTTTGCGGATGACAGAGCGTGTTCAGCTT
CTACAAGAGGAATCTACGCAACTCGGCTTGTGCGATGATGAGATGGCACCTATCGAGCTGAATGATGCCCAAAAAATAGAATTGCTGGAAGAAAAGCTTT
CAGACGTACGAAAGGAAGTGCATTTGTTGAAAGATACCCAAGAGTCTTCGATGCGTTCTGATTCGACGAATGGTTCAACGAACATGGAGGACGAAATTGA
GCTTGTAGGTGTCCATGTGCTCTGGCTGTCGCAATAGCAGGAATTCTAAATCTGGTTTATCAGACACAATGCCTTGTCAGAAATGTCAACACAGAAATCC
ATTCGCAGCATACACGTTTGCTGTCATTGCTCCGTATACTTGCACCCACAGAAAGCATCGGATCGCTGATGGTGCGGCTATACCAACAGCTAGCGCAATT
GCCGAAAGAGATTAGAGATACTTCCGATCCTACAACAGCAACTCGACATACAGTTAAATTACGGGAATTCCTAAAGGTTTGTGGTGGCATCACGCTGACC
CACGTCATCTAATGCTGTTGCTTTACTTCTTCAGAATTGCCCAGACACGTCAGACGGACAGCGTGCCATCGAACTGATGCAAAAACTGCGACTAGTGTAC
GCGTACGAAAGTAGCGGCTTGATGATCTTGGCCGATTAGCCCGATTGTTTTTTTGAGATACAGCATACCAATCATTAAAACGAGTCACTGCTATCCTTAC
TATCATACAAATTTGTCGGGATACGAGTCAATAAGAATCGAAATAAAATCACAAACCTGGATTCTGCAAAGGACGCGCTCGATTCTTCTAATTCTTCTTC
ATCGCTATCGGCTAGTGGCAAATTTGTTGTGTGTGATATTTGTTCGGTAGTAATTAATTCAGATTGTCTTGATCGTTCTGCTTCCTGTTGCTGTTGTTCC
TTTTCCGCAGCCCGTCTAGCTAGCACTCGCTCACGATATATGTCAATAAGAGAATCCTCTTGAGCCTTTTCTTTTTTTGATACGTTAGAGTCTTTTATCT
GGGCTTTCTCTTCATGCTGATCCACAGGAAGCATGACGTCCTCTCTTTTACTTTCGAGAAGGTCCATACTTAAATTATTCCCATCAATAACAACATCTTT
TGAGTCGTTCAAATCCTCAATATCAACTTGGATGGTGTGATCCGATTGCTCATCAAATGACCTCGAGGTGGCTGTCTCTGTGCATTGTTCACGGTCTTGG
AATTGTTCGGGAACCATTGCGACACCTGTATCCTCGGCAAGAGCTCCTACGTCGCTTTTGACAGGCACCGTGGCAAATTTTGTAGCAGCTGGCATCTCTT
CTTCCATAGGATGGACGGAGCAGTCAGCTTCAAGCGGAAATCCATCCTTTTGTTCCGTTTCAGCATTTCCATTGTGCTTGGAATCTACACTCAATTTCTC
TTCCACATCGGGTCCTGGTTCTTGCGTTGTCACCATTCGACTCACATTAATAGCAGAGACTTCTTCAGCCGGTCGCACATTTTCGAGAGGTTTGTCGTTT
TCAAAACTGATTTGATTTATAGGGACGTTGTCGGTATTGTTTGCTCTGGAAGAAGCCCTGGGGAATAATTCATCATGGAAACGTTTTTCCGTTGTTTGCA
AGGGTACTTTGGGTTCAAGAAGATCATCCACAGCAACAACCGGTATCGTGGTTAAACAATCAGTTTGCTCTATATCAGTAAAAGCTTGATGTCGCTCTGC
AGTTCGCGGCTTTAGCTGCTCTCGCCATCCTTGATCGTCATACGTCGGCATGGACATCATTGGAGTCGTTTGCGAAGGCTGATTACCGATTGAGCTTCCC
TCTCTGAATTCATGTTCCACTATAATTTCCTTCACTCTAGCTGCCATGGAAGGCATTTCTGCATTGGTCGAATAGCTTT