Description :
From Genome Similarity Track
Location :
Scaffold_8:268887- 271204
Transcript NameFunction/comments
Physo_356909exonuclease 1, putative
Physo_522873conserved unknown protein
Physo_386866methionine aminopeptidase, merops subfamily M24

Sequence
2317 bases(100 bases per row)
CCTTAAGGTGCTGCTCAAGTCAACACACAATCAATCAGTATTTTCCACATCGTATAAACTCCCGGAAAGCTTCGAGCGACAACTCACCTGGATGACTCGA
TGAGCCATGTACGGCGACACGTCTGCGGCTCGAATAAAGCACTTGCGGGCCTCACTGAAGCGTTTGTTGTTGTAGTGCTGGACACCCAACTCTCTGTTCT
TCTGTCGAGCCTTGCGTCGCTCTTCCTCCGTGCCTTTCTTCATAGGGAGAGGGCCTCCGTCGAACACAACGTAAGGCGTCACGCCGTTGTGGAGCAGCGT
CGTGATCCGATCCATGAAGTACGTTACATATCTGCGCGGCAACATGAGACAGCGGTCATTGGTCATGAAAGCTATGCACATAATGTATCATAACTGCAAC
ATTTACGCACTTGTCCGTCTCCTGGCCGAGACAGATCTCCTGGCTGCACGAGTAGATGGCGCGGTGGAGCCTGGACAGTAGAGCAGCGCACCGTAAGAGT
CAGCGCCTCATTCAACCCTCCCACACACTGTCTCCATACAATGCGGGGCCGCGCCGTACCAGCAGTAGCCGTCGATGGCGAGCGTACGGCCCCTGTACTG
CTCGATGGACTTGGTCTCGGTGATGCTCTTGAGCACCGGCAGCAGCCCCGAGATCCCCATAGCGACTGCGTGGCGTCGCTGCTCGTCCGTCCCAGTCCGA
CCTCTTCCCTGCTGGACGGGCGAAAGCGTGGATTTCAAAGTAAAAAAAACACATAAATAACAAGCGTAATTTACCGATGGAAAATCTAACGTTGTTTTGA
ACAGACGCCGGAGCAGCTGATGAAGATCACCGCCGTCGAGCCCCCACCGTTCTTCAGCGTCAATGCTGCGCTAGCTGCAGGTTTGTACCTCGTCGACGTT
GGACTCAACTCCTCCATCGAGTACGGGGACTTGCCAGGCCAGGACGCATCGGACAACAGCAGCGATGCCATTGTCACCTTGTAAGTGGGCATAATGCGCA
GTGTGTACACCCCTGCAAGGGGTATCCACCTACTACCGAGCCGTGCAGTGTGCAGGTCCTGCTTCAGATCACAGCTCTCGTCAACCTGCTCGTGATGCTC
GGGGGCACGTTCCTGTTTCGCAGCGGCCTGTTCGGCATGCTGTACACACAGTTTCGTGCAGTATTGCTCTCGCAGCTGCTTTACATCACGCTAACCATCG
TCCTGGACGTCGCTCGAGTGGTATGCAGTCTACAGCTTGCGAGTGTGCCAACGTTTACCTTCTAAGTATGCTGTTGTGTTATAATGAGGCAGCGCTTACT
TTCATCGGGGATTTCCCACGTGGACATTTGGGACGCGCGAGGATACACTGCGTGTTCCAGCATCCACAAGCTAGGTAAATATTGGCATCTTTTCCTAGAA
ATGCTGTCTTCAGTGCACAAACTCAAACAGGCTACATTGGTTTGGCTTGGTGATAGGTGCACTAGGTTACTATGCCTGCAGTATCTACGCCGTGGAGCAG
CTCCGACAACAAAATTTTTACACTCATGAGTACTGGATGCGAAGATGAAAACGCGCATGTATTAATACAAGCATCGTTGATTAATACGGGTTCACCTGAG
TACTGAGTACATACATGTGTTGCCGCTCCACCACCACGTCACATTAAAGCGGGCGCTGCAACTTTTCCTGACTCCACTCCATCACCGGCTCAATCTCGCG
CGCAGTCAGGATTTCGTAGCCAGTCTCCGTCACAAGTAACGTGTGCTCAAACCGCGCGGAGCGCAAACCGTCCCGGGTAACGGACGTCCACTCATCAGGC
CACGTCTGGTCACGCCACGTTCCAACGTTGATCATGGGCTCAATCGTGAAAATCATGCCAGGCTTCATAATGCCAACAGCTTTGTTTTTCGCGTAGTGGG
GGATGTCTGGAATCGCATGCATATGCGTTCCAACGCCGTGCCCACAGTACGATTTCACAACCGAGAAGCCCTCACCATTCGCAACGGCCGAAATGTGCTT
GCCAAGCTCGCGGAACATCGTGCCAGGGCGAATAATCGCCGCCGCGGCCGCGGCCAAGCTCTCGAACGTCGCCTTGACCAGATGCACGCATTCTTCATCG
ACATTGCCCACCAGAAACGTTTCGTTCAAGTTTTCCATGAAGCAGCTATTTCGCTCAAGCTGTAAAAAAGACAGATTATTATGCGAAATAGCTCCAAAAA
CGCTATTTCAACTCGACCACAGCCTATTTACAGTTAATGCATGTACAGAGTAGCGCTACCAAAACACATATACGAAGCAAAACCAAAGCCAAAACAGAAC
AGCTCGAGAAGCTCTAT