Description :
From Genome Similarity Track
Location :
Scaffold_516:26887- 28687
Transcript NameFunction/comments
Phypl_g9074hypothetical protein PHYSODRAFT_547717

Sequence
1800 bases(100 bases per row)
gcgcgactgcagcagctcgaagagtGGACGCAGAACCCGGCGGACATCCCGCGCGTCACGTGGCTCTCCGGCATGATCAACCCGCAGTCGTTCCTCACCG
CGATCATGCAGGTCACGGCGCAGAAGAACCAGTGGGAACTCGACAAGCTCGTGATCCAGACGGATGtgctcaagcgccgcaaCGGCGAAGTGGACGCGCC
GTCGCGCGACGGAGCCTACATCCACGGCCTCAACCTCATGGGCGCGCGCTGGGACATCCAGAACAACACGGTGGATCGCTCGCACCCCAAGGAAATGTTC
TCGCCCATGCCGGTCATCAACTGCAAGGCGGTCGCTTCCGACAAGCTGGACATCAAGGGGTCGTACGTCTGCCCGTGCTACAAGACCGAGTTCCGCGGAC
CCACGTACGTCTTCTCAGCGCAGCTCAAGTCCAAGTCGCCCCCCGCGCGCTGGGTCCTTGCAGGCGTCGCCCTCATTATGGATATCGTGTAGTCATCTTC
TTCGATGTAGAGCATGCCTCCTAGCCGTCTTGACTGGTAGATAGAAACAATATTTTCAATACTCTGCTCTTGTGGATGTTCCGGGGCTCCCCCTTCTTCA
TGAATTATTATAATAACGTTGCATGCCTAAAATATTGGATGCGGGAAAACGGCACAAGATCAAGAATGCGGCGCGAGGTGATAAGAAAAATAGTGGTGCT
TTCGCTGCAAGTTTGCGAAAGACGCGATTCTCGAAGACCAAGTTGGGGAATGTGTTGCCATAAAGCTAGCTGTCGGGGAAGGCGAGGAGTTAGAAGTCGA
AGTACAACATGTAGCACTCCTGCACATATCCGCATCTGTTTCTAGTTGCAGGAGGGACACCTTTGAACTCCAGAAGCAAGGCGTGTCATTGCTTCACAGA
GGCGCAACTTGCTACCACACCAATGTACGACCTTCGTATCTGTGGTTCTATGTGCGAAGCTAAACTAACTGCCTGAGCTCGCATTCTGTGGCGAAGAGCG
CTCCAGATAATGGTGGAGCATTACGCTCAGACCGTGCCTTGAACATTTGGGCTCGCACGCCCAGACTCGTGGCGAAaaacgagctggacaagtaGGCTAC
AAATGGAAACGTACCCATCCCCGAAAACAAAGTCGTGCGCCATCCGACGAAGCTCTAAAATTCCTACTTTTTTAATATATGTACCGGTATAGTAAAACAT
ATTCTAAGAAGTTCTAGGCGGCatctgctgcgccagcttcgcagTCGAGTTATCTGCTTTAGTGCTATGACGAATCGTCATTGGCGATGCCGGCCGTGTC
AATGAGAGAGTGAGTGAGAGGTAATTCGTatctcctgcgccagcttcgcagACGTAGGATCTGCATTCTATAATATTACTTctcaccttcgcgcaacaaC
AGCGAGATAGTCCTTCTCGCACTTAAACGAGGGGGGCAACACAGACAATAGAGAACTTTAGATCTTGGATTAACTCAACATTTTGGAACAAAAAAGCCAT
AGTCCAAAAATATATTCCAGTGGAACAACTCGTTATTCCACTGGACctattgtgcctttcacccCTTTTGGCGGATCGGATTTGAAAAGCTATCTTTTCC
TCAAGAGGGTTAGGTTCAACACAGCGAATGACGATTGCTCACCTTGGAAATAGACATCTCGTCAAATCATGGCGGAAGCCCTCGGCAAGGCCTTGCAAGC
CCCGTCAAGCCCCGATTGGCAGGTTTATTTCAGCCATTCGGTACAATTGATCGAAACACGCACATTCAAAAGTAGCTCCCACGAAAAGATCAACCCTTAT