Description :
From Genome Similarity Track
Location :
Scaffold_293:26886- 28168
Sequence
1282 bases(100 bases per row)
aaatatgaactgctagcatgcaagaacacgtctcggcatctgtccagtcatcagcgtaccggtcgagatcattaactgtggttcgtcaggctgcagacag
ccctggataaacttacactggtaatttgactttgtcttgtatgtgggcatggaaaagtctacgtaaatcggcataacacacagctacacgctgaaaaaac
cgttatttgctgggggatcgatttaatcacgatatgcttgctgtctcgagaaagatgtgcctcctcagagaaccaacacttattcccgcagttagggata
tttcaccatctaccgggtatcccggtgggtttatacccggtcccagtaaaagacccagtctttgaccagaaaatgccgaacatggaaagtgttctaTTGT
ATCCAGGCAAATATTTCTGGCTGGAGGTGACAACACGGACTTTACCAGGGAAAAAACTAGCGAACCAAATTCTTGGTTTTGGCTCGCGAAGAAAAGGTCC
CGAACAGCAAATGTCTTTGATAGCCGACGCGCAATGACCGATGCCCGATACCGAGTTACGTAACACAGTACCTTTACCTGTGTATGCATCCAGTTATCAT
AGTACAAACATTTTCGCTGCCAACCAGAATCTCCTGTAGTGATAACACTATATGACGTTTTTTGTTGTTGTAAAAAGATACTTTAGTTATAGTTTAGACA
CTTCAGATCATCTACATAGTGTACTCCGCAAAGAAAATCACCGTACACGAATAAAAAACTGTAAGTGCAGCTTGCGTCTGTTTGCGCCTTGTCATAGCCT
CCAAAATAGTTGCAAATTCGTTGCTCGATACCACTACTTTGTCAATAGAAAAAATAAACTCAtggaggacgctgcacgcagtcatcggcggtatccgtat
cGTTCCTTCCGCATTGAGATGCATTAGTGTTACTTAATTAACTTCTTTGGTTAGGATAGTATTCGTATAGCGAAATTGGTAAGTATAAACAATATCCACC
AAACCAGTTCTCCTAACCTCGAAATAGCTTCACGGTAAATCCATCTAACTCCACCAAAATGTTTTTCTGctatacagtaataaacagtttgcacacgcta
gcgtttgctatacggttaatgtttgCGCGAAGTATAAGATCATCACTATGAGCTCTATGTATCGACCGAGACTGCAATAATCCTTAATGCACTTCCACGA
TACTCGAATTTCACTATTTTCAGCGTCAATTCGCAGCAAATTCGTTTTCGTTTCGTTTCGAATTGAGGAGTATTGTTGTCAC