Description :
From Genome Similarity Track
Location :
Scaffold_344:2688- 8769
Sequence
6081 bases(100 bases per row)
CATGAGTGCCCTTCGATCTAGTGCCTCCAAGGCCGACGTTCGGCTCGAGCGCAAGCTGCGCTATGAGTTTGCTAAGCTAAAGGCCAAAGGCCAGCTACGT
TCGCTGTATCGCGTATCGCACGCACTACGCAAAACCAGTTGCTGGTCCAACCACCACTATTTCGACTGTGCAGACAGTCGCGGGTCACTCGGTGTTGGTG
AGCGATCCCTACACCCCCATACCTATTGGTGGGAACGCGCTGGGGTGAAAGCTGACCCACAGCGCGACGCTCAAAATCGTCAACTGGGTACGGGCAATCT
TGCCGAAGGGGTACCTCAAACTCCCATGAGTTTTCAGACTCAGGGTATCCACGCCACTTCACCAGATAATGGTATTGACCTTTGTGACGACGCCGCTTCA
GAAGTCTCTCCACATGGAATTGTAAGTTCCCTTGCTCGTCGAGCAACGCAGGAGGGGTCGCTGTGTCGGCACAGGCTCATGAAAACTTGGTGTCAGAGGT
GAAGCGACTCCGAGAATCTTTCGCTCACGTGCAGACGGCACTGGATCAGTCTGTGACTGAGAGGAAACAAATCCGGGAGATCCTCGACCAAGTGCAACGC
GCTCGTGAACAGTCATCGACTGAGTTGGCTCAGTTGCGTGAGCAGATGAAACGTCTCGGTTCGATCGACTCGTTCGACAAGCGACTGAGGAAGGTGGATT
ACAGCCTGCCACGGCTGGATGGACAGGTGAAGCACTTAACGAAGATGCAGCTGGTGGGGACGACGTCCCTCCCTCAGGCTCAAGCGCCGTCCGATCCACG
AGAGAAGGACCATGATATGGCTTAAGCAAGCCAACGTAAAGCAGTGGGTGCGTGCGCAACTTGCGCGGGAGATTGATTGTATAGGCAAGGCCTTTCTTCG
CTATTACCGTAACACAATGAAGACGGCAGACACTACATTTGTAGGTAGGTTTTAGCATTTAATAATACTTGGTCTCCAACTTCATAAGAATCAATACATC
CTCTGTCTTTAGTATCAGCTTGTTCTTTTTGTTTGTCTTGGCTATCAGCCATTGCATCACGCACATGTCGTAAGAAAGCGCGTCGCGAGAAACGCGCTCA
CTTGTTTCTGCATCGTGGTAGGGCTGATTTCAGCAAGTTTGTCAGCAGACTCTCCCCCACCAAGCCCAGAATCACATAGTAGTAACGTGAGCGGAACGCG
GGGGTGCGTGAGGCTATTCACATAGAAGGGAGTAAATCCGGTCGAGGCATGAACAGCGTTGTTCAACGCAAACTAAATGATAGGGAGCATCGAGCTCCAA
GTCTTAGGCGACTCAGCACAAACACTGCGAAGAACGTCGCCAATGACGCGGTTAACTAGCTCAGTCTAACCATCGGTCTTCGGATGATCCGCTGTGGACA
TGTCCAATCGCGTGCCAAGCACCTTGAAGATGGAAGTCCAAAACTTGCCTGTGAAGCGAGGGTCGCGATCAGAGATGATTGCTAGCGGCAACCCGTGTTG
ACGAAACACACGATCGATAAACAGCATAGCTGTACCTTTGCCATCGATGGAATCCGGCACCGCCGCCAAGTGAGCCATCTTGCTTAAACGGTCAACAAAG
ACCACAATTCCCGTATAGCCGTCACAGTCTTTGGGAAGACCAAACACAAAATCCATACTGATGGACTCCCAACACCCCGTGGGAACAGTTAAACTGGCGA
GTGGCGCAGCCGAATGTGCTGAAGGTTTGACCCGCTGGCACGTTTCGCATGTACACATGTACGTGCTCACCCATTTGTAGAGTTTGGGCCACCAGTAGTG
TTGACTCACAGAGCCATAAGTCTTTTCCTGGCCCAACGCCCAATGCCCACTGAGGGCAATATCTTGGGCCTCGAAGAGGATTCGATACTTTAATTCCTCA
TCGTGAGGTACAACAATGCGAGCGGTATCCGCTACATCCGTGCGATAGCACAAAAGACCATTATCGATGGAATATCGATGTAGGCTGGCCCGCAAGCGTG
CCGATAATTGACTGTCCTAGACCTTGTATTCCTCCTCACTCCCAAGGGCATGAAACAATGCCACAAACTGAGAATCCCGTGGATATGCCACACGAATTAA
CTCCTCAATAGGAGACGACAAAGTCGTGACATGAGCAAGCTCATAATCAGGTCTGCGAGAGAGGGCATATGCCAACACATTTTGTTTGCCTGGCTTACAC
TTCACCTCGAAGTTATATTCCTCAAAGAAGGAAAGCCACCGAGCCATTCTCTGAGAGAGGTGAGGTGACTGTGTCACCGTGCGTAATGACGCATGATCCG
TATAGGACGAATGGCTTGGAGCCAAGCAGATGGACTCTAAATTTGACGAGCGCATACTTCATAGCAAGTAGCTCTTTGTCATGAACTGGATAGTTCTTTT
CAGCAGCTTTCAGCTGACGAGACTCAAATACGATAACTCACTCGCGGACTGCAGTATCTGTTTGTAGCAGGGCGCTGCCTACAGCAAAATCGGATGCATC
GCAGACAACACTAAAAGGGTACTCAGGATTTGGTGACACCAAAATGGAAGCATGGAGGAAACTCTCCTTTATTTCCCGAAATGCGTCAGCATGGGTGTTG
TCCCAACGTCAATCTGTGTCCTTCTTAAAGAGATCAGTTAATGGCCAATCCATATCGGCGTAATTTTCACTGTGATTTTGTAAGTAATTGGCAAGGCCAA
GCCACTTACGCAAGTTTTTTTGATTCTTGAAATCGGCCAGTTCACTATAGCCTTGACCTTAGCGGGATCCGCTCTAAGGCCGCGCTTACCAATGAAACAT
CCTAGAAAAGGAATCTCCTCTACACCAAAATGCATTTCGACGCGTTGGCGTACAATTTATTAGTGCGCATGCACTCGAGCACGGCTTGCAAATGACCGAT
GTGATTTTCAACATCTGACCGACATTTTTCGTCCCAACTATGGACCAAAATGTCATCAAAGTACGTCTGTGCGTAATCGCGATGTGGGCGAAAAAGTTGC
GTCACCAGACGATTAAATGTTGCCGGAGCATTAGACAGCCCTTGGGGCATCACCAGCCATTCCCATAGCATACCACTGGGGGTGCTCACTGCTGTAAGCG
GAATATCACTCGCTCGCATGATTAATTGATAATATACATCAACCAAGTCGAGTGCGCTATACATAGTACAACCAACCATGTTTTTTTTAATAACATCCTT
CCGAGGAATGAGTGTCTGTGCCGGAATAGTAGCCGCATTAAGCTTGTTATAAGCATGCACAATACGCCACTTCCCGTTCGGCTTTTTGACACAAATGTCG
GTGTCGAATATGGAGATTTACTCTCACGAACAATTCCTGCCTCGTGCTTATCACGGAAGAAATCATCAATGACATCACATTGCTCCTTAGGCAAGGGCCA
CTGTCGTGTGACACAATATTTAGTCCCAGGAACTAAGTCAATTTCATGACGGACACCTCTATCTGGAGGTAGAACATAGGGTGTCACACTACATCTTGAA
ATCACTTCACTAAGGAATAAAAGGGATCATGACGGTCTTCCAATATTGATGACCCACTACGCGCCCTGAGTGCTGCTTTTTTGTCCTCCAGAACGGCTTC
ATCCAAAAGTGAGAAAGAGTTCAACTCTATGATGTCGGGTCGAATGACCACCACCTCTGAAAGGTCTCCATTTTTTAGTGAGTGATCAAATTCATCGATC
GACAACCCTTCAAGTTCTAAAGCGAACTTAACGAGGGTATATCCTCAAGGCTAATTGTACCATCACAGGCACCAGTCACTCCGTTGACGAGTGTATACAG
CTGACAGTCATCATCATTTTATGACACAGCACACGATGTGTGATTCGTATCTCTCTGATCGATGCCATCATCGAGCGTAATTTGCTCTAAACTAGAGCTG
ACGTCACTATTGACATCCGATGACAAGTCATTGGACATGACGTCGTCATCGCGTGGATTACGTGCCACTTCACGTGCATTCGCTGAGCCGGGCTCGAGAT
GCCTTGGTATTTCACCAGCCATGTCAATATTGACATCCAGCACGTCGCTATCACAGCCAACTTCACTCAGTGGGTACTTACGTGCCACTCCGCGCTCATC
TGATGGGTTCAACCCTCGATGACTTGACGCTTGGTCAACAATGCTTCAGCATTTAGTACGTTGCTCTCACAACGACTATCACTTAGCGGAGTACGTGCCG
CTTCACTATCACATATCGAGCTTGCTCTATACTCATGTCTTTGACATCGTCAGAATCAACTAACTCTGACATTCCGATGTCCAGCACACTGACATTATCA
GCCAGTGACTCCGCCAATAACGCTTCAGATTCCTAGCCGAGGTGGGTTCATGACTCTCCAAAGCTCCGCTAGGGGCAGTGCGCGTGGCGCCTAATGTTTT
CGACCTCCAGTCGATCCATGTCTCATGGCGCTCAAGCCAAACCATACGAAGAATGAGATCATATCTCGAGTCCAAATCGAGGACTAAACAGCGTCCGATA
CTCCCAAAATCGAAAAACGTCACACCCAAGTTCGCAGGAACTTTGGGTGCAGTGACTAGAGTTCCTGTCGCCAAGCGAACAGTGATCGTATCATCCTTGT
GCGCTTTTAGCGCCTCAACATAACGTAGATTCCCTTCAAGGAAACAGCGTCTGACATAATTACCGGACACTCCGGAGTCGATCAAAATAGACCAGGGATT
GTCAAAGCCCTTAACAGTCGCCTTTGCGACCAACAAGCATGGCTTGTATTCACGTCCCGTGTTAAAATGCACGGGAATCCTTGGGGCTAAATTCCGCTCG
CCATTACCTCCTGGAGGCTCAACAGAACCTAGTTCTTCCCCAGCAGGGCGCCCCGCGCCTACTGGGAGTCTACGTTTTCCCGCACCGTACCAGACTTCTG
GTTAGCGGCGGGAGTTTGGCCTGAATTAGCCTGGCGTGCCCTGCGTGAAGGGCATTTAGGTCGCAGATGCTTTGTGATTCCGCACGTGAAACATCGTCGA
ATGTTTCGATGCTGTTCTACAGCTCGAAGCTCTGCTTCTTCGTCCGTTCCGGCGATACTGAGGCCCATAGGCTCCGGACTATTAAATGAACTAAAGGAGT
TCGCGGAGTACGGGTTGTACCCATGGGTGCCAAAACGGGCTGCCTTAAAGTTGAACTCAGCGTTCAACGCGATATCCACAGCCGCCTCAAAGGAGGTGGG
GTGTACCTGTAATACTTCCGTTTGAGCCACGCCCGTACGAAGGCCCTCCATGAAGATGGTAACCAAAACCATTTCTGGTAAGGGATCAAGCTTCATGGCC
GTGATTAGAGTTCTCAGTTCCTGGACATAGTCCGATAATTTTTTCTTGCCCTGACGGGCAGATAGGAAACAAGGAACGCACCCGGTATGCCTGATTAGGC
GGATCAAACACCCGGGATATTTACTGTTTTAGCAAATCCCACGTGGGAAAAGCTTCGTCTACCGACGAGCTACACGTGATAGCTCATTCTCTGGCTCGAC
CACCTAGTTTCGAGATAGCCATCCCAACTCGCTATTGCTCCGACCGGAGCATAGCGGAGTTCGTGGCCATTTTCACCTCTCTGGTCCACAGGAGGAGATT
CTCCCCTTCTGTTCCCTCAAATGCCTTTACAGTCAAGACAAGGGGGCGAGCCCTTGGCTCTTCATTAGGTACGGGGACATACCGAGTAGGCATAGCCGAT
GCCAAATGGTCGTGTACTTGCCCAATCAAAGTGGACTCAAACTGCATAAAAGCGTCAAGACGTGCACGAATCACGTCAGGACCTTGTGCGAGAAGTAAAT
CCACTTGTTTGCTCTCGACTAGCGCTCTGAGTTTCTCCAGCGCTAATCCTTGGGCCTCAGAAAGGGTTATCTTGGTTTCCATCCTTACAGTGGAACAGTC
TTTAACAGACTCAGTTGTAGATTAAATACAAGTGCTAACAAGTGCAGCGGAGCTACCCTTACTCCTTTGTCAGAGGAAGACTTCTAGACTCGTAGAGTCT
CTCAGTATATCAAACTAAACGGGTATTGACTTAAAGGGTCTCAAGTCTTACAGACTGCGTGAGACTTAACTCTAAGTGTAT