Description :
From Genome Similarity Track
Location :
Scaffold_1492:2688- 4595
Transcript NameFunction/comments
Phypl_g13547hypothetical protein

Sequence
1907 bases(100 bases per row)
GGTACGGGATAAGTAGGCTCGCGTGGAggctcgcagcagctcagccTGCGTCCGCGCGAGCTCGGCCTGCGCCGCAATGCGTGCAGACTCGGCGGAAGAT
ACGGACGCGGAGATCGCGAATCCGGACTACAccacgctggtgctcctCGGCGTGAACCACCAACAACGCGTTCGCGCGGAGCGTAGAGCTCGCGAGCAGC
CTCGACCTCGTGACGACTCTGCTGAAGATCCCGCCGAGCCACGCGCAATTCTTCCTCCACGTCCCGGAGACGACGGGCGCtagcggctgcagcttgaacc
ACCCCATCACGCTCGGAGACGATGACCGACAGCTGCGCCTGAACGAcggtcgactgctgctgggctgcgGTCAGTTCGCCGCATACGACAGCCAGTTCAT
CGCGTACGGTGGCCAGTTCGCTGCGTCCGTCGGCCAGTTGCCCCGGAGGCGAGGGAGGACGGGTGGCCGCAGCCGACCGCACCTCTTGTTCGACGACCCG
CGCGCGTTCACCGGCGAGTTCCGCCGTCAACTcagcgactcgagcacgCTCGGCTGCGAGTTGGTCTTGCAGCGCGTGTGATTCTTCCGTGGTGACGTTC
AGGAGAACCTGGTACTGGGTCTCAGCTTCGGCAACGCGACCAGCGCGCTTCTGCAAAGGAACCATGGCGTCGGCCAAGCGGGCGTTCTCAGCGCGAAGAC
GACTCAGCTCATCTTGCAGCCGACCCACCGTCTCCGAGCCGATATCGAGACCCTCGCGGGCTCGTCGAAGGATAGCGAGGTTCCGGTCATGCAGGACGGA
CGCACGCACAGCAAGACCGGCGTTCAGAGCGGTCGAAAGTTCCAAACGAGACCAGATGACGCCGTTCTCCTGCTCAAGGGTGTTGGCGTCTGCCACGATG
GCGTGCACCGACCGAATGGAATCGCCAGGGCCCGGGAGGTTCACCCGAGACGGCGCAGGAGCGAGCACGCGACGGAAGCCGAGTGCGCAGACGTTGCACC
GGCCTTGACTGAGATCGTCGGTGTCCAGCTCGATGGAACTAGTGCTGGAACTGGACGACATCCCGGAGGGCACTTCGGCACCGTTCTAAACGGCAACAAA
CACAGACGATGAGGACAACGCAGCCGGAGGCAGGTTCTGCTGCGACGCTCGCACCTGGGGAGTGCGCACGTGCACCAGCGGGACGGATGTGGTAGAGTGG
CCTCCAACGAGAAGCCAGAATGGCGCGGAGCACGGTGGACGGCCGGGGTGACCAAGATCGATGGGAAACGAGCGACGCGCGATCCGCGGGGAACGTNGAG
CGCCCGACCGGAGGTTCGTCCATACGTCGGATCGGGGTGACCCGTCTATGTGCCCGATCTACAGACCGAGATCGCGATCCAAGATCCCGATCCTGTCCCC
GATCTAGGGCCCGATCCAAGGTTTACGTCAACATAGGACGTGCGAGTACGACAAGTCGATGGATACGCAATGGGGGGGCTAACAGCTTCAAGTAAGTCGG
TGGGTACACAACGAGAGGCGGCCAGAACTTCAAGTAGGCAGCTGATAGGGAACGATAGGATAGGGTAAGGCGATCAGTCCCGAATATTCTTTGAGATACG
CAAGTGGGAATTCcttcgtgctcaagaaccNGACTCAACCCCACAATCCCGTGCCCAATAGGAGGGACACGTTAAACGATACCGTCCAGGAGCCGCCCAA
TAAcgcgacctcgacgacgaagacctgCGCTGGTCCGATAACGCCGTGCAACCGAAGAGAGGGAGAGAGGAGGACGCCGCTgcgcacgagcaggacgTCG
AAGCAAGAGAGACGCAGGGTGAGGACCATCCGCGCTGCGTCGAAGCANGACGCAGTCTGCACAAAGGACGCGACGGGTTTGTGCGAGGACGACTTGGCGG
ATTTACG