Description :
From Genome Similarity Track
Location :
Scaffold_1:2687884- 2691011
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00687hypothetical protein
Phypa_INRA-310PPTG_00688zinc (Zn2)-Iron (Fe2) Permease (ZIP) family
Phypa_INRA-310PPTG_00689RING-box protein 1

Sequence
3127 bases(100 bases per row)
AGCTTCAGGACGTTGAGCACGGTGCTCGAGTCCCCAGAAAGCGCTGACATCTCAATGTAGGCAACGCCATGATCACGACACCACGAGCGAGCTGCGTCGT
GCTCTTGTTGGGTATCTTTGTCGATGCAGTCGCGTTTGTTGCCGACCATCAAAACCGGCAACGACGTCCCTGATTCAGGTGCAATCGTCTCGATCGCGGC
GATCTCTCGACGGGCGACGTCAAGGTACGTGGGCAGTGCTCGCCACGAAGCTGGCCTCTGCAAACTGAAAACCAGCACTACTGCCTGGGCACCGCGAAAG
TAGCGCGCAAAGATGCCTGAACCGGCATAACTCTGCGGAGGCACGTCCCATAGCTGCGAACACCAACCTGTCAACATGATATGATTTCGTCACCATTAAG
TAAATATGTCAAGGACGCACTTCAAAAACTACTGGCTCGCTTCCCTCCAGTCGAAGCAGCTTGGCACCTACGCTAGCTAATCGACGAGTTGTTGTTGGAT
GCTCATAAATCAGTGTTTAATTACACAGAACAGCCTCGCTTGCTCACCCGTTGTAGACGGCACGTAGTTGACGTCGAGCGGAGATCCCATCCAGCGTCTG
AAGAGGGTTGACTTGCCCACATCTGGCTCGCCCAGTATGACGACCTTGATCTTGTTCACGGACAGCGAATCCGAGCCCGTATCTGGCACTGCAGACGCGT
GCTTCCACCGGCTTCTCAGCAGCCTGCTGGATGCTGATGCAGCAGCAACACATCATTAATCGAGCACTTCAAAACCGCGTGTATACGCTGTCCACGTTAG
CAAATACAGGTAACAAGACCGACCTTGTGCTCCCATGCGTCGTTTGCCAACCAGACAGAAGGTGCCTCCCGCCTTCGGACAATTCTATCTTAATGATAAA
CCTTGCTAAACGGATAACATATTCTTGCCACAAAAAAAACTAAACTGATAGTCCATAAGAATTTCAATAGTCAAACGTTTTTGCCTGCAAGACACTATAC
AAGTACTGGAACTATGTGTACAACACTAAGTTTTTCGCACATCCACGCATTGGTCCGCCGTCGGATAAGCTGAATAATGCGGACTCACGAGCGAGGAAGC
CCAGCGCTGTACACAGCTCTTCACTCTGCGATTTTCCGTAAAAGACGCTGACATCCTCTGCACAACCTGCTCAAGCGATGGACTCTGTGGATAAATTCAA
ACTGGCTGCAGCACTCTTTATTTGGGCGCTGGGACTTATCGGCGGCATTGCGCCATTGCTGAGCAGCCAGCGCGTGAGCAAGCGCGCCAGTAGCATACTG
AACATGGTGGCGGCCGGCATTTTTCTCGCTAGCTCGTGCATGCATCTACTACCGGACGCGCAGAACAACGCAGCTCTCACGGAGTGGGGCTGCGAGCACA
CTGCCGAGGTCTTCCTGGCCGTGCGTACTCGCTACGACGGTGATAACAAGCGTTGCTTCAAGTGGGCCAACTTCTTCTACGGCTGCGGCTTCCTCATGGT
GCTGCTCATTGAGGTGCTCGCACACACACTGCAACGGCACTACAGTAAGGTGCAAAATGGGCACAGACAGCAAGAACACGATGCGCTGCTCACACTCGAT
GGTACGCGAGCCACCGAGGTGAACAATCTAGCCAAGACTAATGGTCACTCACACGGTCACGCTCACGGTCACTCGCACGGCCAACTAGAGACTGGAGATT
ACGGTACCCAAGGAGCGAGTACTGAGCTAACTCTCCACGCAGAAGACGACAAGGAGGAGCCACACTCGCACATTCACGGCATTGTCAAGGGCAACCCTAT
CCTGGCGCTTGTCGTGTTCATCGCTCTGTCTTTCCACTCAGTGATGGAAGGTATGGGCATGGGAGCCTCGAGCAGTGCGGCTTGGGATATCCTCGTCGCC
ATACTGGCTCACAAGTCGCTGGCGGCGTTCGCACTTGCGCTCGAGTTTCTACACCACAATGTCTCGCGGAAGCAGCTTCTATCCACCGTTGCAATCTTCT
CGCTTATGACACCTACAGGCATTTTGTTCGGCCGATTACTGGTTGATACTAACCATGCGACGCCTGCCGGTGGTGTCTGTGCTGCATTCGCTGGTGGCAC
CTTCCTGTTCGTTGCCATCATGGAAATCATCCCCCAAGAGCTGCAAGACCCTCGATACCAGATTGAGAAGTGCTCTGCTCTGCTCGCTGGCTACGGAGCC
ATGGGAGTGCTCTCCCTCTGGACGTAAACGTACTTTTGAACTTATGTATTCTCGAAGACAAGAAGCTTCGATCGTTAGGCATTCAATAGCCCATAAACCG
ATTCGCGTGGTGTGAATGTCAACTCAGAATTCGCTGATAAAACGTTAGTAAAGAAGTTAATGAGAGAAAGAACGTACTCAAATAGCTAAAACCACGCCTT
GGAAGCTCTTTCTTCTCTCTCGAGCTGTGTGGCCAACTCCACACCACAATGTGCTTCTACAGTACTTCGACGCAGTTGCCGTCGCCAGCAGATACACAAG
CGATCCGCATCTCTTGAGCTCACTCCAGCGTTGGCTCCAGTTATCTACCGTACTTCTGAAACTCCCACTCGCGGTTGTCCAGCGGACACACCTGGCGAGT
CTTGAGCCACCGAGAAATGCAGTGAAAGTGGAAGGCGTGGTCTACAACGAACAATAAAAATATCTAGTAAATGGTTCGTATCAACCCAGATACAGCAGCA
GCGCGGACGTACTGCAGACACCCCAGGCCACCGTACACTCCTCGCTGGTGGCCGACGCTTGGTTGGCCTGGCATTCGATGCATAGGTCCATAATGTGATT
GCGGCAAATAGCGCAGTTGTCCACAACGATGTCTGCGTAGTAATACATGAATAATTAGTTGCTTGAAAGATCTCGACTGCAAAGTGTCACGGCGCGCTCA
CCCCAGGACCAGAGTGCCACAGCGTTCCACTTCTTGATCTCGAAGCGCTTCTCCTCGCTCGTGCCCGCGGCCGGCGCCACCTGCGTTTCGCTCTTCATCT
CCTCGTCCATCGCGATCGCGATCAGGTTGGCTCTCGCTTTGGCAACCTCGATTGTGAATGGTTTCTTCCTCAAAGGCCAGAGTTCGTACTTAAACGTAAT
TTCGATACTGGTACACTGTACCACATG