Description :
From Genome Similarity Track
Location :
scaffold_191:2687- 5521
Transcript NameFunction/comments
Pl_107970hypothetical protein PHYSODRAFT_547810

Sequence
2834 bases(100 bases per row)
CTTGGTGGCTTCGTGCTGGACGAGCAGGGCGAGGAGGACCTGCTCCGCGAGGCGCTGCAGACCGTGCGCGACCAGGGCTTCCGCATGCAGCGTGCCGCGG
ACGCAGGCGACCAGGCGGCCGTGCTCAAGCACGCGGCTGAGGTGCTACGCGAGCTGCGTACAAGTCTGCTGTCCCCAAAGAATTACTACCAGCTCTGTAA
GGGATATTGCTACTATAGCTTAATGGAAACTACACTGACTTATTGTTGCTTCTATTGCAGACATGCAGGTGATGGACGAGCTACGGCATTTCGAGAGCTA
CGTGGAGGAGCAACAGCAGGCGGGCGCCTCTATGCGAGTGCTGTACGAGCGTGTTCAGAGCAGTGGCAACGTGTTGCCGAGACTGTACGGGATGGAGATA
TTACAGCTGAACCAATACTGCCTTCGATCTAGGCACTCATATTTTTTGCTTCTGTGATGTTGCAGCTATTTGTTGGTGACTGTAGGCTCGGTGTACATCA
AGTCTCGGGAAGCTCCAGCTCGTGACGTGCTGACAGACCTGGTGGAGATGACTAAAGGAGTGCAATACCCGCTGCGAGGGCTCTTTCTACGGCACTACTT
GTCACTTAGTGTCCGTGATAAGCTGCCGGACACAGGATCCGTGTACGAACAATCGGGTGGGGGCACTGTTAGCGACGCAATTAATTTCTTGCTGCAGAAC
CTACGAGAAACCAATCAACTCTGGATCAGACTGCAGCACCAGAAAATTGGCGGATCTAGACCACTGGCTGTCCGAGAAAAGGAGCGAATGGAGCTACGTC
TGCTTGTAGGAACTAGCTTGGTGCGACTTAGTCAGATGGAGGGAATCACACGCAGTGTCTACTCTGAACAGGTACTGCCTCGGCTACTGGACGATGTTGT
GCTTGCCTGCAAAGACTCTATGGCGCAGCAGTATTTGATGGACTGCATCATTCAGGTTTTCCCGGATGAGTTTCACTTGCAAAATCTTGAAAGGTTTTTG
GGTGCAGTGGAAAAGCTGCATGTAAACGTCGATATCGCGTTAATTTTGACGGCGTTACTTGAACGCCTTACCAAATTTTGGGAGACACAGGGTAATGTCC
CCAACACGGGTCAGCCAGAAGTAGGGGCGGACAACCGTAGCGAGCAGGAGCAGGTGCAACGAGAGGGGCTTCAGGTTTTCAAGCAGATTATGGCTACGAC
ATCTAAACTGCTGTTGCGCTCGTCACGATACGGTGTTGGAAGTGACACCCCAAGCGAAGGCGGCGGTGGCGACGTACACTTGTCCTCCGTGTTGCCATGT
TTCGTGACGTTTGCTACGTTCACCCTCACGTGGCTGGGTAGCAGCACCAAGAGCATGAATCCCGACACAACAGCATCGCTAGAGCACCTCGTTTCTGGGT
GCTTAGCTTTTTTGCGTGAGCGAACCGCGTGGCGTGTCGACAAAGATAAACAAACGCGCCAACTCGTGGTCTCACAGCTTAAAACTCTCGCGCTCACACT
TCTTCGGGCACTGTCGATCCAGGATCTAATGCAAATTCCGGTCGTGCGGGAATTGCTCGCACTACTACCGTGGCAGGGAGCGTGGAAGGATGTCGCACTG
GTGTGGATCCGTGTCCTTTTAGCACGACATGAACGCGTTCACGACGAGAAACAAATGGATTTCTTGCTCCAGATTCTGGCACCGTTGGTGCGTGACGACC
CCAACGAGTTGCAGTCACTACCTCTACCCACCACTACTGAAACGGGGAAAAATAAGGAGGCTGAAGTTTTTGAAGCTGAGCAACAAACACTGGCCAAGGT
AGTTCAGCTCGTAACCAACGATGATCTCGATGTCAAGTATCGAGTATTTTCCCTGGCGCGCCGTGCATTTCTGCAGAGTGGCATTTTTCGGATTCGTTTC
ACACTTGTGCCGCTAATTTACCAGTCGCTGGCACTTGCTCGAGATTTGGCAGGACATTCCCCGGAGACGACGCAAAGTCAAGGACAAGAGACGAAAGCGG
AATCAGAAACCACGTCAACTGCCGAGAACACCAGGAGTTTTGTTACAACACCTCGGGAAGTTCTTCAATTCGTGCACGAAATGGTGACGGCGTTGGCTTC
TAAGCAAGACGCACTGTCTGTTTCGTGCGTCCACTTGTTTCTGCAGTGCGCCCTCGTAGCCGATAGATGCACATTTGAGGCAGTCGCGTACGAGTTTATC
ACTCAGGCTTTTATTGTATACGAAGACCAAATCACGCTTGCACGGGAACAATGGCGCGCTTTAGAGTTAATGGTATCATCCCTGCGTGCGACCCGCAATC
TCTCGAGTGCTAACTACGAGGTTCTCGCCACCAAGACCACACAGTACGCCGCTCGGTTGCTAAAGAAGAATGAGCAGGCTTTGATGGTGCTGAACTGCGC
ACATCTCTTTTGGGTAGGGATTGCTTTGAAACTAGTCTTGGACAATGTTGGTATGGATGTATTACGCGTAATGTTAAACATTTTTGTGGTTGTAGCACCC
ATCTCAGCAAGACGGTAAGCGTGTCCGGGAATGCCTTCAGCGATCGCTACGAATTGCAGATGCGATTAAGGACACGACATCAAACCAAGTCCCCCTCTTC
CTGGAGATTTTGGAAGCTGTACGTTGTCTTAATGTTGCTTTCGCTGATCCAGACCCGACTAACAAACTGTGGCATAGTATTTGTACTTTTTTGAAATGCA
GACACCCGAGATCACGCGCAACTACTTGGTGGGCCTGTTGGCGCTTGTGAAGGATCATCTAGATAACATGGAACACGGGCAAATGCGCAGGGAGGGCGAA
TTCCGTTATCGCGCCATCGTGCGCTACATGGATA