Description :
From Genome Similarity Track
Location :
Scaffold_24:26860- 32779
Transcript NameFunction/comments
Phyta_totarag1319hypothetical protein PHYSODRAFT_286439
Phyta_totarag1320hypothetical protein PHYSODRAFT_302462
Phyta_totarag1321hypothetical protein

Sequence
5919 bases(100 bases per row)
CATTCACGAAAAAGACCGCAACGTAATACATGACTTCGTGTTCGAACTCCAGCGTtggcagcacgcgctcgctgcagatgcagcagccctTGACCATCGG
CCAGAAGTATCCGTACGGCTCCGGCagcggccgccgccactcCTACCCGCCACCGACGCCGCGCACGCTTCGCAGGCGCTCCTGCCTGCGCAAGGAGAGC
ACCTTCACTTGCGGCGTCGCCTCGCGCGGTTCGCGTCTGGATGAGCTGTCCACGACCAAGATGATCACGGTTAGCTACTCGTCCGCGCCAAAGAAGACGC
TTTCGTTCGCCGACCAGCGCGGCCAGCACCTTGTGCTGGAGCGGGAGTTCTGCCCCGCGGACGCACCTGTGTGCTACTGCGACGTTCCCGTTGAAGTCAC
GGTCGGCCGTCTGACGCgccaacgcagcagcagcctcgacAAGTGGTTGGAAGAGACTGTGGCgcgccagcacctgctgtCCATGTGCGTCGTCTCTCTG
CTGGGGTGCGCCCTCATTGGTCTCCACCAAACCACCAAGTAGGCGCTAGCACAGCATCTATCTACCCATGTACAAGTAGTAATTATTTTATTCGTGCGTC
ACTTCGTGGAAGTGCAGTTGGCATGAGCGCCACTAACTTATTAGTAATAAaaaccaccagcacgcaCTTACTGCAAGTACCGTTCGCACGTTATTTCCGG
CGCTTCGTGGCCCACGTCTTGCCGATGGCAGGGAGTTCCAGTCGATGCTTGTCCAGctcgacgcgctgctgcaagatgctgctcaaAATTAGCTCGGGGG
AGTAGATCCGCTCTGGATTCGCGTTCACAAGCTGCTTGCGCACCGTTGCCACGGCCAGTGCCGCCTCACTCGTGATCACCACGTCATTTGGTCCAGGCTT
TCCCTTCGACGACGCCTCGCCGCCCGCGCACTCCACGATTTTCACCAGATCCTTCACCGGCGGCAGCACGGACTTGTGGTTAGTGATAAACACGCTGTAA
CCAGCGAAcagacgctggcgctgctccgCGGACACGCCATACATGGTGCTTCTCAGATCGAACTGCCACTTGCCCTCCGCCTCCTTGTCTCGAAGGCAGT
CCGCTTGCTCATCGACCGCCGAGCCGACCCGCGCCGACTCGTCTAGCCAGCGTTCACCCAGAATATGCGCGCAGCACGAGATACTACACAGCAGTTTCAC
CGTGCGCTTCAGTTGGTTCTGAGGGGCAATCACATGCGTGGCCTTCTCGATGTTGCTCTCGTAAACTGCGCCGGCAATCAacttgatcttcttgcgAATT
GCAGCAGTGGGCTCCAGCCCAGTCAGAATGACGCGAATAGACCGACTTTCTGCTTGTGAGCCCGCAGACTCGCTGTCTGTAATCAATCGCCTGCTTGCCG
CCCGCTTCCTGTCATGACTCGAGGTAGGTGCCTTGCGCTGAGAACGAGGTGTTAAACGCGACGTAGGCTCCTCGCCAACCACAGCTCCTCTACCAGACAG
GCTGCTCTTGTCTTCTTGAATGTCTTGATTTAGTACCTCATCACCAAGTTGGGAGCTACTACGAGGTGTTTTTAAATGCTTCTGTTGAATATCTTCTTCA
TTCTTCCCCGATACTTTCTGTTTCTCCAACGAAACTGCCTGATCCAAGCTGTGTGAAGACATTCCAGCCTCATTATAACGGGATCGTTTTGTCTTCACGT
GGCTCCCTTCTGGGGCTTCACTTTGGTTCCGTTTTGAGCTGCGGGACGGCAAACTTAGCTTGTGTGTCTTTTCCGGCGTCGATAGCGATTGTCGTATACT
CTTCCTTTGCGGGTCAGATGCATCCTCTTTTGCGGTCGCTTTCGAGTAGCTTGCACTCTTGGCCAGACGCAGTGGCAATCTTTCCTTAGATAACGTTTGC
CTCTTATCTGTTGCTGATTGGCTTTTCGCCGGCGATTCCTCCTTTGGTTCACCTTCGATCTCAGTCTCGCCACCACTGCTGTCCGAATCGTCACGAGTTG
AAAGAGTTGGAGATACTCGAAAGGAGGTACGAGGCTTGTAGATTCGCTTCTCCAtaacttcttcttctttttctctTTGTTGGAAAGAAGCAGCGATCGA
GGACAGCCCCGTGACAGAGCCGTCTTGTTCCAGCATGTCGTCCGACATGTCCGAGtcagcatcttcgtcactgtTCCCCATTCCAGTGTCACCAAAGGAT
CGGCTTGAAGCTATTGGCAGCGGTACTGCCTCCTCAAAAATCTTCCTTTCTGGCCTGGGCGCTGCACCTAGAACCATTCAAAATCTCCCTCTTTAGTCAC
TTTCCATCGATAACTCTAATTCAAAATGCAGTTGCACTCTCTTACCGTCCTGCTCTTCAGAATTTGTCATCCGGATCTGcgtctcttcctcgtccacctc
gtcttcatcctggTGGAGACCATCATTCTCCTCTTGAGATGGCATGGCAGTAACGAACACTGGTGCGAGACTCTCCCCAGGCTGCGTCGCCACTTCCGTC
GCCTGACTATCGCGTTGCGTCGGTTCTCCATCCAATTGCGACAACGCGGCGCGCTTGCGGTGGTTGGCGGTGTACCATTGGCCAGGTGTGTCTCGGAACC
CTACGGGGGTCTCCTGTCCCGACGAGTCCTCGTCAAAGACACATGCGGCCCCGCCAGTCATGAGGCTTCCACTCGTCGAATGCAAGCAAAAACTGTTTCA
GTCTGTTGCCTCAATGTGCGAGGCTATCAAAGTTTATAACCTGTAGAAACGGATGTTTTTAAGTTTGGCTACCAGTACAAATCTGGCTGCAATCTCATTT
TAGCTTGAGCAAATTGTACAAATCACAACCTCGCTATTGGGCAAATTACTGTAAAATAAAGGGAAAATATCTATTTTACGTGTCGATtaggaagttgaag
tcagTAAAGCGAGGTAGTCAGAATTCAACTCAAAAGAATCGCTTCAAGCTCATTGagctcggcgctggagagcaTGTCGAACTCGTAGACTTTGGTCTTC
TGCTTGCCGCTGCTTTTGCTCGTCTTTTTGGCTGAGATGACGACGGCGTAACGCTCGGTCATGtccttcttcgacgacagcgaccGAAGCAGACCTTTCT
TGGACGGCGACGGTGGAGGACTGGCCTTCCCAGTGTCCAGAGCTGAGATATCGTCGAAAGCAATGGCCGACGTCTTCGCTGAGCTTGGGGACGAAGGGTT
CAGTGGAAGGATATGCAGACACTTGTTAGTCTTGTCGACTACCAAGCGGCTTGATGAGCGAGCGCCTGACCATGAAGCCTGCTggcacgacagcgacaga
GGACGTTAGTACAGCAACCACAGGTCAAACCAATGCGACTTACCATGGTGATCATGAACTGGGTCTGCGATGTGTTCAAGGTGGGCTCTTGCTTCAAGTT
GGATGACTCGAGTTGAGCTTTGGTGACTTCGAGAGTTCGAATAGACAAAGCAGAAAGTGGACCCGAAGGAGGATCTATCTGCAATGGCGGCGGGCGAGCT
TGCGAGGCCTAAAGACAACAGGTAAACTTAGTGGCGCATCAAGATACTGCAACTGCATGCGTTCAAGCTCTCCTACCTTTGTTGGCAAAGCTGGAGTTCC
GGGTGAGGAGTCCACTCCTGCAAATCTGACTGTTGATTTTGCTGGCGGCGGATCAACAGCGGAGGATGATGATGTTTGCTGCGGGGGCACTATTGGGGCG
AGATCGATTGCTGAAGAACCTTTCAATATTTTTTTCAAGACCGGAGAACTTGgtgccgacgctgctgaggGGGTTTGAGCTATCTGATATTCTGTGTCAA
ACGTGAGGGTCTTCTGTGTCCCGGCAAGGGCTTTGAGAATCCCGATAATGTCGTGCAATGCCAACGCTTGAATATGAATGTTGTCAATTGCAATGAGATG
ACTGCCAACTGGAATACCGTCGTCGGGATCACTTTTGGTCACACGTGCAGCATTTTCAAGTGAGCTATCAAACTCGATTCCCATGGGGGATCTTGAAATG
ACTACATGCTTTAGCGCTGGTTTGCACGTGGGGCTAATCATACTGTTGTATGCCGCAGTTGTCGTGCCAAAAGTTATGACCTTTTCGTGAGATGCAAGCA
AGCGCAGGAGCTGAGTCAGTACTGCGATATGCAGCGAGCTGGTGTCAAATCCGTCGATTGCGAGTATCTCGGATCCGCTTACGACACCCCCGTGGCTCAA
AATGTGCGTCGGACCGCGCGCGAGATCCTCGTTCACGCGATCCACAACTACTCCTTTCTCGCTCGTTTTCAAGTCGATGCCCAATGGACCAGGTGGGACC
CGAATACTCACCGCGCGAGGATTGCACTCGCTGTTTTCTGCTTGAGTTGAAAACACTAACTCTTTTGGAGCCGAGgccagcttttgcagcaaacTGACGA
TCTGGCCCAGGGCCAAACACGTCACGTTCATCTTGTTAATGCTCTGCAGTCTGGATCCAACAGGAACTCGACCACTTTGCTCAATCACTCCTGGCGTTCC
ATCTGCCATGGGGTTAAATCCTGATACGCGGGCGCCATCATCCCGCTCGCCATCGAATTTGATGCCCAATGGTCCAGGAGGCACGATGATAGCTATCAAC
GTGCGAGAACCTTCTAGCCGACTCATCAAAGATGCATTGCCAACCACGATCTGCTTCGGTGTGTGGCGTAACTTTAAAACCAGCTTGGAGACCTCGCCAA
GAGTGTGTTGGTGCACATCGAGCCCGTTGATGCCGATGATGTAGCTGCCAGGAATAATGTTTCTCAAAGGTTTGCATGTTGCGCGATCCGCATCTTCTGG
CGTAGTGAAGCCCGTGATTCTAGCGTGGTCGGGGTCGCTGCTGTCTAGATTCAGTCCGGACGGCCCCGCATCAATTTGTATAGCGTGGCATTCCGGCAGA
ATAGTTACCTCTTGGTGATAAAAGGAAAGCGTTCTTGGGTATGGCGTTTGATTCAGCAACTCCATGGCAAGAACTCGACTCATTCTCGTTATGTCAGTAT
TATTGACACCAATCAAGATATCGCCTTCCACGATTTTGTGCCCGGCAACAGCTTTAATAGCAGACACCACGCAACGAAAAATTTCGGTCTCAGAGATAGA
GACTCCCATGTCTTCAGGTGGAAcctcgagctggaagaatCTAACGCAGTTGCTGGGAGTCATGCGATACAGTACGATCTCTTTGTTTTGCTCTCTCATT
CCAGCCAAAACTTTAGTAACCTCGTCTCGTGACAGTGCAGACACGTCCTCACCGTTGATACAGACAATCTGACATCCGCGATGAACGTTTTGGCATTTTC
TGAGATGACTTTCGGAGCCATCCGGAAGTTGCTGAAAGCCTTCGATTACGGCACCGTAGTGGAGAACATCACTGAGAATTAGGCCTAGCGCACCGCTAGG
GGCGTGAACCAGAACCAACTTTTCCGGATCGTAGTCTTTGATGGTGCGCTGCGCAGGGTGATACCGTGCGAACTTCAATTGCCGCTTTTTCGCCGATAGC
TTCCCTAGACGAGTGATGACTTCAGACAGACTGGAATGAGCAACACCATCGCCGTCAATTGCTACCAGTCGATCGCCTGTACGAACTACTTGGCGCATGA
CAGATAGAAGTTGTTCAGCGGTATTACTGGTAGTTGtttgatctgctgctggaattTCTCCAAAACCTTGAACGATGACGAAACCACGCTCATTTTCAAC
GAGCAAGACGCCCAGCCGACCAGCGGGAGCTTCCGCGACGAAGTACTCGCGACCAAACTCGTCCACAGCCATACTTTACTAACCAAAGCAGCGCCAGTTC
AGAAATGCGCATCAAACACACTGTCCTTATCCATCGCAAGTAGTATTTTGAATCTCTTTGTCGTAGCGTTCTGATCTTCACCTCGGCGGTAAATATGGAT
GAGCGTCGGAAAATGGAAA