Description :
From Genome Similarity Track
Location :
Scaffold_1197:2686- 4333
Sequence
1647 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGCTTCAACTATTTTGGCCAGTACCATAGGGGCTCCACGGCGGTGTTCCTGTGCTGTG
CGCGGCGTAATCCAATCCACGTTGAAGGAAGCCTCAAATCGAGGTGGGTGGTGTAAGCTGGCTTGAACCAATAATCGACTAGACCTGTACAGCATGGGCA
GGACTTACGTACACAGTCTATTTTCGGTGATATCTTGGAGTTTGTATAGGCAGCCCATCACCCCACAATGTGACGACCTTCCCGCAGGACGGATGTCATC
CGCGGGAAATGGCTTTGCTCCGCTGCGCTCCGCAAAAGCAGTCGCTGCGCTCCTGCGATAAAAAGATTATCTCACCTGGCGAGAACAGTGCTCGGCTCGC
TGGAATGCTCGTTGCTGGGCCCGCCTCCGCAAATACCGCACGGCCCTGCTACGCGGGCACCCCGCGCGGGTTTGCTGTGGCTACGCTCCTCGCAACCGCG
AGCCTCCGTTGGTCCTCTTCTATATCACGTTCACCCCCCCCTCCCCCCTCGACCCCCATAAAAAAAACTGTGTACGTAAGCACTCCCGTACAGCATGGTG
AGACCATACCTTGCTCATGTTCGTCGCGACGACCTTGCCGCGGTGGATACATGTACTGTCGTAATGATAAGAAGCACGTCAAATGTACCCCCTATGAGTG
CTGTAGCTTCACTGTACTCGATACACGTAAAAACCACAGTGTGGTTCCCTTAGGTCCTTGTTCAGGTGCCAGTACACGTTCTTAGTGTTTCCCGGGCTAG
GGTGTCTAGTTTGGGCCAAGCATTTTCAGGACGTGTGCTACGGCTTGTCCAAGTGGGTTCTGTAGTGTTTAGTGTGCTGGCCACCCGTTCATTTTGTTTT
CGCACGAGATGAAAGCACAACGTCGCCGCAATGCCACATAATTTCCC