Description :
From Genome Similarity Track
Location :
Scaffold_1197:2686- 4292
Sequence
1606 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGCTTCAACTATTTTGGCCAGTACCATAGGGGCTCCACGGCGGTGTTCCTGTGCTGTG
CGCGGCGTAATCCAATCCACGTTGAAGGAAGCCTCAAATCGAGGTGGGTGGTGTAAGCTGGCTTGAACCAATAATCGACTAGACCTGTACAGCATGGGCA
GGACTTACGTACACAGTCTATTTTCGGTGATATCTTGGAGTTTGTATAGGCAGCCCATCACCCCACAATGTGACGACCTTCCCGCAGGACGGATGTCATC
CGCGGGAAATGGCTTTGCTCCGCTGCGCTCCGCAAAAGCAGTCGCTGCGCTCCTGCGATAAAAAGATTATCTCACCTGGCGAGAACAGTGCTCGGCTCGC
TGGAATGCTCGTTGCTGGGCCCGCCTCCGCAAATACCGCACGGCCCTGCTACGCGGGCACCCCGCGCGGGTTTGCTGTGGCTACGCTCCTCGCAACCGCG
AGCCTCCGTTGGTCCTCTTCTATATCACGTTCACCCCCCCCTCCCCCCTCGACCCCCATAAAAAAAACTGTGTACGTAAGCACTCCCGTACAGCATGGTG
AGACCATACCTTGCTCATGTTCGTCGCGACGACCTTGCCGCGGTGGATACATGTACTGTCGTAATGATAAGAAGCACGTCAAATGTACCCCCTATGAGTG
CTGTAGCTTCACTGTACTCGATACACGTAAAAACCACAGTGTGGTTCCCTTAGGTCCTTGTTCAGGTGCCAGTACACGTTCTTAGTGTTTCCCGGGCTAG
GGTGTCTAGTTTGGGCCAAGCATTTTCAGGACGTGTGCTACGGCTTGTCCAAGTGGGTTCTGTAGTGTTTAGTGTGCTGGCCACCCGTTCATTTTGTTTT
CGCACG