Description :
From Genome Similarity Track
Location :
Scaffold_321:26855- 28572
Sequence
1717 bases(100 bases per row)
GAACCGTGGTCTCAATTTTGTCTTAAAGACTGCAGACACTGCATGAGTAGGTAGGTTTTTTGCATTTAATAAAACTTGGTCCCCGACCTCAAACCTTTCT
TCATTGCGTCTGCCTTTGGCATCTGCATGTTCTTTTTGCATATCTTGGCTTTCAGCCATAGCGTCGCGTACTTGACGCATTACGCTTAGTCTCAAAGAGA
CAAAGTCATTGACTTGCTTGCGAACCGCAACAGGGCTGACATCAGCTAGCCGCTCGGCTATCCCTCCCCCATCAAGCCCTGAGCCACTGCGTGGCGGCGT
CAGTGGGACGCGAGGGTTAACCAAGCCGTTCACATAGAACGGAGTGTAGCCTGTCGAGGCGTGCACTGCATTATTTAATGCGAACTCGACGAGTGGGAGC
ATCTGGCTCCAGCGTTTTGGCGCCTCAGCGCATACGCTTCGGAGGATATCCTCCACAACGCGATTCACGCGTTCTGTTTGACCATCGGTCTGCGGATGGT
CCGCTGTGGACATGTCCAAACGAGTGCCAAGCACTCTGAAGAGGGACGTCCAGAACTTCGCGGTGAAGCGCGGGTCTCGATCCGAGACAATTGCCTCAGG
CAAGCCATGTTGGCGAAAGACTCGGTCTAAAAACAGCAAAGCTGTACCTTCACCATCTATGGTGTCCGGCACCGCCGCTAAATGAGCCATCTTGCTCAAT
CGGTCTACAAAGACCACAATACCCGTGTTTCCTGCCTTGTCCTTGGGAAGGCCAAACACAAAGTCCATACTCATGGACTGCCAACATCCCTTGGGGACAG
GCAAACTCGCCAATGGCGCTGCCGTGCTCGGCGCGGACTTCGTCCGTTGACACGTCTCACACGTGCGTACATAGGTGCCAACCCACTTATACATCTTGGG
CCACCAGTACATCGAGCTCACCGAGCCATAGGTCTTCTCCCGACCTAAGTGCCCGCCCACGGGCGTATCATGAACCTCATAGAGGATTCGATACTTTAGA
TCCTCATCATGAGGAACGACTACACGAGGGTTATCCTCAGAGTCGGTGCTGTAGTACAGCAGGCCGCCATCGAGCGAGTATCGATGCAGCCTCGCGCGTA
AGCGCCCAGACAATTCCTTGTCAGAGTCTTTAAACTCTTCGCTCCCAAGAGCCCGTAGCAGCGCTACGCACATGTCGTCTTGTGCATACGCTCCGCGTAT
CAAGTCAGGCACTGACGACATCACTGTCGTGACATGAGCTAACTCGTAGTCCGGCCTGCGCGAGAGCGCATCGGCCACTACATTAAGCCGCCCCGGCTTG
TACTTCACCTCGAAGTTATACTCGGCAAAGAAGGAAAGCCATCTTGCCATTCTCTGAGAGAGATGAGGCGACTGTGTCGCAGTGCGTAACGACGCATGAT
CAGTAAAGATCACAAAAGGCTTAGAGCCTAGCAGGTGTACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCTTTGTCATGAACTGGATAGTT
CTTCTCTGCAGCTTTGAGCTGGCGAGACTCAAACGCGATCACGCGCTCACGCCCTTCGGCGTCTGCTTGTAGTAAAGCACAACCGATTGCAAAATCGGAG
GCGTCACAGACGACGCTAAACGGACTATCCGGGTCCGGTAGCGCAAGGATCGGAGCCTGGAGAAGGCTCTCCTTCACAGCCTCAAAGGCTCCGTCGTGCT
CGACGTTCCAGCACCAT