Description :
From Genome Similarity Track
Location :
Scaffold_1194:2685- 4833
Sequence
2148 bases(100 bases per row)
TCGCTTCTCAACTGTCAACGACACCGTCATTGGAGGCGGCAAACACGACCAAGGAAGACCTGCGAAAGTATCGAAAAGGACAACAACCCCGAAGGGCAAC
AACCCGGCCGGATCCAGATCCAGGCCTCCAGATCCAAGTACAAGACTACTGGATTTGGAGTACCACCGCGAGCAGAGTGAAGATTTCCGCGCTGCTCCAC
CCACATCCCCGCGTCTCGCCCAGACTGTTCTGTCTTCAAGGCTCGGACGCTTCAGCAGACACCAGAGGAGCAGATCCAGCCCTACCGGCGGGTACACAAG
GTGACCAGTTCAGCACACAGATCACGGATCATCGGGGGACCCCCTCCGTAAGTCGGTGTTCGGGCGCAGTTGGGAAGTTGGATCGGCGATCTTGTAAATT
TTGCTGATCCCGCTACACCACAATGGCGCGCGTGCCCGGATCTTCTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGAAGTTCGAGTGAAGAAGGAA
CAAGGGGATCAAGCGTCTTCGGAATCGGGATCGACGACGACGCTGCTGAATGAAACAAGATCCACGGATCGGCAGAGTGCAAGGAGGACCTCTGTCGGCG
GAACCGAGGTGGATCCAGACATGGATCCAGAAGAGAAACCTCAACCTCCTCCACAGGTCCCTTCAGGGACCCCGGTGATTGCGACGAAAGTCAAGATCCA
CTAACAAAACAAACCAAGGCTGGCCAGGATCGGTATGCATTTTCTGACTCTCCAGTCAAACAAGAGCCCTACATCTTCCATCCAGACAAGACCCAGACGA
AGAAGACCGCTACGAGAAGGAAGATGAAGGCCCCGGAGCTGGAGGACGAAGATCCAGAAACCTCGGCCCAGGATGGATCCGAGGCATCATGGATCCGTCA
TCACGAGAAGCAACTACGCAGCTTTCTGACAGTGGATCCAATTATGCAGAAGTTCGGCGTGAAGCAGATAGGAGCCCTACAGGGACCCTTGACACTTCCG
GCAGCCGTTAAGCGTCCAAGAATCTTGGCAGAGATGGAACGCCTGATGCAGCTGCTGAGGGATGCCGGTCTCGTGGCTGGAGCGTTCGACGCGTCAGTGA
TGTACGAGATCGATCCAATCCAACTCCGTGCCACGACGGAGATGTTGTTGAACCGGCTGAAGGTGATGGTAGGCGAGATCCAGCCGAAGCCGGATCCCGC
AATCCCGGATCCAAGATCACTACAAGATGGATCCACAGGAGGTCGGACGTCGTCACCTTATGTGTCGGCTGCAGAGCTTGGGTCGGACACGTCTTCGGAG
CCGCGACGCATGTCACTTGGACCATCGGGAGCCTCGATGCTACGCGCCCGAGCCCAGATCCAACGCGAATCGAGTCCTCAGCCCCGATCCCAGCCTCGAT
CCAAGAAGCAGTCAGCTCCATCAGTGGATCCAACAGCGACGACATCAGGATCCGACATGTCGACTAGCAGGTTGGAGTCGTTCTTCCAGGCAGCTATGAA
CAGGTTATTGAAGGAGCAGGGAGCTTTAACCCCAGCCATGACACCGAGGGCGGTTCAGAATCACGATTCCCAAGATGTCGAGATGGAGTCCACTGGATCA
TCGAATCCGGACCCACACTGGGAGTCCGACCCTGACGACATTGACTTCCCGGCCCCAGCGCGCGCTACAGTAGCCACCACCGCGACCGGATCCACAGGTT
CAGCCCTGATCCAACGAGTCCGGATCTCGGCGTCTCGGATCTGAAGGAGTTCTCTGGCAAGGACCAAGACGAGGATCGAGCGAGAGCTTGGGTCAGTAAG
GTGAAGTCTGCATTCCTCCGCGATCAAGCACCTGACGAAGAGAAATGCCTGACGTTCGCGGATCTGCTGTCTGGATCGGCGCGGAACTGGTACCGCCAGC
TACCTCGATCCACACGCAATATGTGGTCGGATCTCCTACGCAGCTTCCAGACCCAATACTGTGGATTGGGGATCTCCGTCGCCCGCCAGTATTATCATGC
TCGCAAGCGTTCGGACGAGACTCCGCTGGATTATCTCTACCGACTTAACGTCACCGGACTCCGTGCTCGACTCAAGATCAAAGACGGTGGATCCAAGGAG
AAGCGCGAGCATGTGGACCATTTCATTGAGACTCTGGGCGATCAGGAT