Description :
From Genome Similarity Track
Location :
Scaffold_1619:2685- 4126
Transcript NameFunction/comments
Phyag_g11117hypothetical protein PHYSODRAFT_339979

Sequence
1441 bases(100 bases per row)
GAGCGATCGCTACGTCCGACGTGGATCGTGTACTCGTCCGTGGGCATCGCTATGCTCGAGGCCTTCCACTATGGATGGTCCAACTCGCAAGTCAAcctca
gcaccttcagcaacacGGAAGAGTGCAATGCTCGACCTGTTGAGGAAGGCACGTGCCTCATGTTCCCCGGTCACACCAAGACCACGTGGACGCTGCTAGT
GAACGCGTGGATCGTGGGCGGCATGTTCGGCAGTCTGCTGTCGGGGTTCCCGTCCAACAAGTGGGGACGTCGTACAACGCTGCGCTTCAACGCGATCATC
ATGGTGGTCGGGTCGGTCATTCAAGTGGTGGCCAACAACCCGACGTGGTTCGCTGCTGGTCGGTTCATCACGGGTGTGGCGAATGGTGTGGCCATGGCTG
TGGTCAACACGTTCCTGAACGAGATCTCGACACCGCACAACCGCCACGCACTGGGCACCAACACGCACTTGGCAGCGACGCTGGGTATCTTTGGAGTTGC
CACGACGTTCTGGTACTGGAACACAACGCCGGGTTTCCGCTGGATCGCTGGTATGCCGATCGTGTTTGCTGCCGGGTTCGTGGTGatgtcgttcttcttc
atggtggAGAGCCCGGTATGGCTAGTTGCAAATGgcaaagatgaagaagcggagaaggagttggcaCGACTGTACGGCAAGGAGAACGTCAACGTCATGA
TGGGCTGGATCCAAGCCAACGACCGCAGATCCAAGCTGCCGTCCATGTTGAGCGGTGTATCCGACAAAGTGCACACTGAGACGAACTGGACGATCCtgac
caacaagaagttcCGGAAGCCGCTGATCATCGCGTTGGGGTTGACATGCATCAACCAGTTGGTAGGCATCAAtgccgtcttcttctactCTTCGTCCATC
CTCAAGGACGCTGGTATTTCGGACTCGCGCGCTGGTCTCATGATCATTGACATTCTGAACGTTGTGCCTGTGCCGATCGCCGCTGCGTTGACGAAGGTCA
TGCGTAAGCGCACCATGCTAATCTCCGGCATCTTTGTCATGGTGCTGTGCTGCATCGGTATGACTTTCTCACTGGTGTACAGTGTCGGTTGGCTGTCTAT
TGTCTTCCTCGGGGTCTTCGTTGTCGGCTACGACTTAAGTATCGGTCCGCTTCTGTGGCCGATCGTCGCTGAATTGTTCGCGGATtctgctcgtggtgct
gctgttggtatCTGTATTACCATGAAGTGGATCTGCTCGCTTATCGTGGGTATTGGTTTCCCGTACGTCGAAGAGGCCATCACGAACTACAGCTTCACTC
CGTTCCTGGGAACCACGATCCTCTCCATCATTTTCATCTACTTCATGGTACCGGAGACGTCGGACATGACGATTGCCGAGATTCAGGACGGCTTCCGCAG
CGACCGCAGCGTGCAGTCCTCGAGCAAGAGTCAAGTGTAGG