Description :
From Genome Similarity Track
Location :
Scaffold_168:2685- 4024
Sequence
1339 bases(100 bases per row)
GCATTCCCATCGTCATCAATCTCCATCGAAAGGCCAGGCGAAGACACGCTTGATACATCAGTCGTGGGAACAGTCGGAGCCGACTTCGAAGACGCGGAAG
CTAGTGGAGCAGCCTCAACAGGGGCAGACCCTGCTGTAGAAACCACTCCCGAGACTTCAACTGCCTTGGATGTCGCGGCAGACGCCGAAGCAGACTTGCC
TTGTGGGACAGTCTGGTCTGACTCTTCACCTTCTTCACTCGAGCCAAACATGAGCCGCATTTCCTCGGCCTCGCGCAGAGCCTCTTCAGCAGCACGTATG
TCGGCTGGAGAAGGTGAAATCGTTGAAGCTGGTGACTTGGCCACATCGTGTGGACCCTGAGGCGGGGGCGAAGGCGCGTCAGGAGAGACAGGAACATCGT
CGTGATCCTCAGGGTTCACGTCCTTACCCGAAGGCTCTGTAGCAGTTTCTTGAACCGAAGGGACGCTGCCTGGATCAGCAGTCCCCATGTCCACGTCACT
CTGGTCGCCGCTGAGGTCGACCACTGCGGGAGTCGAGGAAGACGCTGGTGTAGGAGGTGGCGACCATGAACTTGGAGAAGACGGTACAGCCTTGGACCGA
GTCTTCATATGACGTCGTGGCGACTTAGCAGGAGAATGAGGACGGGGTTTCTTGCGCTTCTTCTGGGCCGCCTTCTTCCACGCCTTCGGACCGAACAGCG
ATCTACGAGCCGACTTGGGAGTTGAAGTATCGGCAGGTGGCGCATCACCGAGACCGGCAGCTGCCATCGAAGCACTGGCCTTGTCCGTTGGGATTGGAGC
CTTGTCTTCGTCAGAGTCGTCCGGATCGTCATCTGAATCCTCGCCACCTGGTCTAAGACGCTTATGGGACTTCCCATGGGCCACTTGGTGAGCTGCTTTG
GCCAAAGCTGCCGGAAAGGCTTGAGGATTGTCCGAAGAAGCGGTGGCAGACTGAATACACCGCAGAGCGACTAACGTCTCCTGATCCAAGTCCAGCGCAT
CCAGGTCCAGCTCACCCGCAGTCAGACCTATCACGAAGGATTGTGAACGAACGTTAGTTGCTGAACACACGGTGGAAGGAGCAACATTAAGAGCGTACCT
TCGACAGCCAGACGAAGTACCTCGGGATCCATTCCTGCCAGACTCACGTGTGCACGGAGGGTACGATTCGCTTGGAGGAGGCGAGTGTTACGGTCTTGCT
GGTTCTCGAGGACCTTGAGCGTGTCGTTATCGACATACTTGCCCTGGGCAAGCTTTACCAGAAGGAGGTGGAGCTTCCGGGTCTGCTCAGTATTCGCGCC
AATAGAAGACTTGTACACTTCGCGTTCGCGAGCCAGCTT