Description :
From Genome Similarity Track
Location :
Scaffold_264:26849- 28906
Transcript NameFunction/comments
g10084.t1hypothetical protein

Sequence
2057 bases(100 bases per row)
TTCAGCGCAAACGCTGCGGAGGACGTCCTCCACGACGCGATTAACGCGCTCGGTCTGACCATCGGTCTGTGGATGATCCGTTGTGGACATGTCCAATCGC
CTTGAAGACGGGCGACCAGAACTTGCCCGTGAAACGGGGGTCTCTAACCGAGACGATCGACTCGGGCAGCCCATGCTGGCGGAAAACCCGGTCAATAAAC
AGCTTGGCTGTACCTTTACCATCAATGGTGTTCGGCGCCGCCGTTACATGAGCCATCTTGCTCAAACGGTCGACACAGGCTCGTGTTGCCCTCCGAGTCC
TTCGGAAGGCCGAACACAATGTCCATACCCATGGATTTCCAATACCCAGAGGGTACAGGCAAGCTTGTCAGCGGCGCGGCCGCATGCGGTGAGGGCTTCA
CCCGCTGACACGTATCACACGTGCGCACATACGTGCTCGTCCACTTGTAAAGCTTGGGCCACCAATAGGAGAGGCTCACAGAGCCATAGGTCTTTTCACG
GCCAAGATGGCCACTAAGCGCAGTGTCGTGTGCCTCATAGAGGATGCGATACTTCAGATCCTCATCGTGAGGGACCACAATACGTGGCGTATCCTCCGGA
TCTGTGTTGTAATACAGCAGGCCACCATCGAGAGAATATCGATGCAGCCTCGCGCGTAAGCGCGCCGACAGCTTACAGTCCGAGTCTTCAAACTCCTTGC
TCCCAAGAGCACGTAGAAGAGCGACACACATGGCATCACGCGCATACGCAGCTCGGATCAAGTCCGTCGCGGACGACGTCACAGTCGTGACATGAGATAA
CGCATAGTCGGGTCTGCGGGACAGCGCGTCCACTAACCCGTTCTGCCTGCCAGGCTTGTACTTCACCTCGAAGTTGTACTCCGCAAAGAAGGAGAGCCAG
CGGGCCATCGTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATGATCAGTAAAGATGACAAATGGCTTAGAGCCTAGCAAGTGAACCC
TGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAGTTCTTCTCTGCAGCCTTGAGCTGGCGAGACTCAAACGCAATTAC
GCGTTCACGCTCTTCGGTGTCTGCTTGCAGCAGTGCACAGCCGGTGGCAAAGTCCGAGGCGTCACAGACGACACTAAATGGACGATCGGGATCTGGCAAC
GCCAGGATCGGCGCGTATAGGAGACTTTCCTTAACCGCCTCGAAATCATCTTGATGCTCGGTGTCCCAGGCCCACTCCTCATCCTTCGTAAGGAGATTAG
ACAATGGCCAAGTCATATCAGCGTAGTTCTCGCTGTACTTGTGCAAGTAGTTGGCGAGGCCAAGCCACTTACGTAAGTCCTTTTGGTTCTTGGGAACCGG
CCAGTCAACAATGGTTTTGACCTTAGCGGGATCCGCTCGAAGGCCGCGCTTCCCGATGAAGCACCCTAAGAAGGGAATCTCTTTAGCACCGAAGATGCAA
TTGGATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAATGGTCTATGTGGTTGACCACATCTGACTTCCTGTGCTCCGCAC
GACTGTGGACGAAAATGTCGTCGAAGTTAGTCTGTGCATACGCCCGATGGGGCCGGAAGAGCTGCGTCACCAGACGATTGAACGTCGCAGGCGCGTTCGA
CAGCCCCTGGGGCATCATCAACCACTCCCAGAGCATGCCGCTCGGGGTGCTGACCGCTGTCAGCGGAATGTCGCTCACACGCATGAGCAACAGGTAATAA
CCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCACGTCGTTCTGGAGAACATCCTTCCTAGGAATAGGCGTCTGCGCCGGAATGGTGGCGG
CTTTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGACTTTCTGACACAGAATGTTGGCATCTAGTGCGGAGACTTGCTCTCGCGCACCAT
GCCCGCCTCGTGCTTCGCACGGAAGAACGCGTCAATGGCGTCACACTGCTCCCTTGG