Description :
From Genome Similarity Track
Location :
Scaffold_1:2684098- 2687793
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00685Rab11 family GTPase
Phypa_INRA-310PPTG_00686threonine synthase
Phypa_INRA-310PPTG_00687hypothetical protein

Sequence
3695 bases(100 bases per row)
TATCTGAAGCTATGCTTCTCCTCTGCCGAAATATTAAGCAACTCATCGATCGAGGCTCAAGGTTCTTTGAAGTGCAGCCATATTGACAATGACAATTGCA
GCAATGCATCCATATCTGTCCAACCCACATAACCTTCAATAATAAATGAATTCCACATATCCATTCTCACATACAATGCATATTTCTGTAAGAAGGACCA
AATCATTCTTGCTCCTCTCCGTCGAATCCTATACTCTCTTCATGTTCCGCCCTGGAAACTGCATAACCGACTCTCCTCGGTCCCGAAAGTTTCTCCGCGC
GCTTCAAGTGGCTCTCTCTGCCAAGGCGTCGCAAACGTCTGCAAGAAGCAGCGCCACACCCGATCTTAACTGTTCCCTGTCACTAGTCGCCTCTTCACTA
TGACCACGGGCAGCAAGCGCGAGCTGCCAGCATCTCCCGCAACGACATCGTCGTCCTCTGTCGATAACAGCAACTCATTGCAGCAATACATCTCGGCCAA
GGAGGTGGCCCAGCATCAGGTTTTCCGCCAAAACGACATGCGGCGATCTATCAGCTCCACACAGTTCAGCCCAGCTGTCAAAGGTTCCACTAGCCAAGCC
TCGGTCACCGGATCGTCCATGTCGGCCTCCAACAGCCCGCGTTGTTCGTCCCCGGCATCGTCGCCAATGGCCGAATCCATTCTCAAGGTTGTTCTCATCG
GCGATTCGGGCGTAGGCAAGTCCAATCTCGTCATGCGCTTCACCAAGAACAAGTACATGCCACAGAGCGTGCAGACGGTGGGCTTCGAGTTTGCCACCAA
GACCATCCGCGTAGGGGACCGACGACTTAGAGCACAGATCTGGGATACCGCAGGACAGGAACGATTCCAGTCCCTCACTGCTGCCTATTATCGCAATGCT
GTGGGCGCCATGATCGTCTACGACATCACAAACCGCAGCTCCTTCGAGCATGTTACTGGGTGGCTAGCTCAGGTGCACGAGCATTCGCATGAGAGTCTCG
TGCTGATCCTCGTGGGGAACAAATGCGATCTCGCCCATTTGCCGGAGAGTAGAGAAGTGTCGACACTTGAAGCCGCGAGGTTCGCAGCGAAACACTCAAT
GGAGTTCCTCGAAACATCGGCATTGGACGCGACAAACGTCGTGGACGCCTTCAAGAAGCTCATTGTCCCGGTTGGGCGTCTATTGTCACCGACTGAACCG
AAGAAAATCGCGCGGTTACCCCCAGGATGGAGACGTGTGTTATCAAGAACCAGACCGGGTGAATATTCGTACGAGAACCAATATACCAAGGAACGCATCT
CATTTGCGCCCAAAGAGCCTGCAAAACCCTCTCAGCAGAGCTTCCGAACGCCTTCTAATGGGTCCAAGAGCGGAATTCCGAGTGTCGTCACTGTCACACG
CGAGAGTCTTCAGAAACAGCATCAGAAGGCATTTCTCGCACAGAATCAGACGCCGCAGTGTGGTGTATGTGTAAGTGACTGCACTATATTGTAGATGCTT
AACGACTTGCCTTGTGGTCATCAGGTTACGGGCAGTCTATTCTCTTTTTAGCTATTGCGGTCTGCATGCTGACCTCGGACACGACAAAACCGAGTATGTG
ATTCACTCGCAACAAATGAAGATAAGGAAGTGTCCAGGTCCAATAGAAGCAGATCCACTCAATCATTCAGTAACTAAGCGTTTAAGGTCGTGGTCACGTT
CACGTGTTTCAGCTTGCTTGGTCCTACATAAATTACCATCGCGATAAGTTATTGTTCATGCGTCAAGACAGGCATGATTTCTTGTTTTTTTCTCTATGAA
AGCTGCCCTCGCATAATGAACACTACGGATTAAAGTCTGCTAAGACTATCGTATTGACCGCCATCCTTACGTAGCTGTTTACTTCGAGCGTCGAGCCACG
AAGAACGCAGCAGCGACGGTCGCAGCAGCAAGTGCTAAGGTGGCGAGCTTACACTCGGTGGGGGCCGACGTCCACAGACTGAAGCAGTTACTGCAGGCCT
TCTGGTTCTTTATCGCGATAGTCTTGCGAATGTGCTCGGCCACCGTAGCACTCGAGTTTTTGGCTACCGATAGCCGGGTGGGCAGCGATTCCAGCGCCTT
GAGGATTGGGTGTTGCTGGATCTCCGACTCATCGACACCAAGCGCCTTGGACACCACAGGAAGGAACTTGCCGTAGTGGGCAGTGCCAACGACTACCACC
GCAGAGTTGGGCTTGTCAGCAAGGTTATCCTGGCCAAAGTGCATGGCAGCTGCAGCACCAATAGCGCTGTGCGGGTCGAAGAGGTGCTGGTGCACCTTCT
TGTACTCGGCAATAGTGGAGCGCACCTCCTCCTGGAGCACGGCGTACGACGCCATCTCGTCCTGCGCCTTGGTGAGTAGCTCACCTGAGATCGTGAGCTC
ACCAGTCTGCTCAAAGCCCTGCATCCAGCCGCGCAGAATGTCGTGATTCTCGCCGGACAGAGCGAAGAGATAGCGCTCGAAGTTGCTTGACACACAGATG
TCCATGGACGGCGAGATCGTGTGCTCAATGTCGCGGCGGTGGTACTTACCCGTGGAGAAGAAGCGGTGAAGGATGTCGTTCTCGTTAGTGGCCACGATCA
GCTTGCCAATAGGAACGCCGAGCTTCTTGGCGTAGAAGCCGGCAAGGATGTCTCCGAAGTTACCAGTGGGGACGGAGAAGGCAACCTCACCGCTCACGCC
CTGCTCGCGAGCACGGAAGTACGCCCACACGTAGTACACGATTTGTGCCAGGATACGAGCAAAGTTGATGGAGTTGACGGCTCCCAGGTTGTACTTGGCC
TTGAAATCAGCGTTGGCAAAAAGGTCCTTGACGATAGCCTGGCAGTCGTCGAACGTGCCCTTAACGGCCACGTTGTGAATGTTCTGGTCCAACACAGTGG
TCATCTGGCGTTGCTGGATGGCGCTCACGCGGCCCTCGGGGAAGAGGATGAACACCTCGACGTTCTCCTTGCCGCGCAGGCCATAGATGGCGGAGCTTCC
GGTGTCACCAGAAGTGGCGCCTACGACAGTGATCTGGTGCTTGGATGCGCCAGCGGGCAGCGCCTCGTTCTTGCGCTTCAGAAAGAACTCGAAGAGATTG
CCAAGGAACTGCAGCGCGATGTCCTTGAAGGCGAACGTGGGGCCATGGAAGAGCTCAAGCACCAGCATCTGGTCCGTCACCTTGACCACGGGCGCCACTT
CCTCGGCGCGGAACGTGGTCGAGTTGTAGCTCTTCGCCACGAGCTGACGTAGCTGGTCGCGCGAGATCTCGCTCTCATCGATGAAGAGGTGCATGACCTC
TACGGCCAATTCCTGGTACGAAAGCGACGCCCACTTCTCGAGCGCATCGGCCGGAAGCGTCGGAAACTCGTTGACCTCAGGCACTAGTAGGCCGCGATCA
GATGCCAGGCCGGTTAGCACCGCCTGTTCGAAGCTGAGGCCGCGAACGCCGCCGCGCGTACTACGGTAGTGCACCATGGTATGTACTGTGGTGTTGCAGG
TGAAACTAAGAGTGCGCTAGTGGCACCGAAACTACGTGGGCAATGTGAGCCGCTCAGGAAATAAGAAACAAGAAACTTCTTGCAGTGGAGACGCGTCCTC
GAATTAGCGCTACATTGGAGCAACAATCAACGATGCGCAAACGGCCATGTGACGTGGCGATTGTGTTGCATAATATGTGTACCACAAAATAGTGT