Description :
From Genome Similarity Track
Location :
Scaffold_1184:2684- 3811
Sequence
1127 bases(100 bases per row)
TTCGCTGAAGATGTCAATCAGCCTTTGGCAGTTCTTTTGGAAAGTGGTATACCCACGCATGAAATAATAATTGATGAAATCCAAGTGGGCGAACCAGGTG
TCCCAAGGACTGATGATCAAGAGAAGTTGCGATAAGTGATTTGGAGGAGTCGCCATTTGCTGATTGGAAAAGGTAATGAATGCTCTACCACCTGCGGCGA
GTGGGGCAGTTTTTGATATATATGTGGGTGGGGCCAACCCGGTCACGCAGAGGGTCAGGCCTGTGGCTCCCAAATTTCGAGAGAAACTCGCCGATCTGAT
TAAAGAATTACTGTCGACAAGATCATTCGACCATCTACAGCACCATGGGCATCTCCTATAGTGGTGACCATCAAGAAAACAGAGAAGACATAAGGTCGTA
CTTTGATTGCAGGATGTTGAATCCCGCTGACTATGTTGATGGTATACCCTATGCCTCTAATCAGTGAACTATTGCAGGACATGGATAAAGCCATGTGGTA
CCGGTCTCTGGACATGGCGAGTAGTTTTCGGGTGGTGAAAATGATTGAAAGGGCAAGGGCGACTTCCACTTTTATCACACCATCATTTTGTTTTTGAGTG
GTTACAGATGCCTTTCGGGTTGAAAAACGCTCCACAGATTTACCAACGATTGATTGATAACGCTCTCTATGGATATTTGAAAATCGGCGCAAGATCCGAA
TCGATCACGGCCAAATCGATGTCATCAGCGATGGTGAACCCGATACTTATTCGAAACCATCAGTGTTGTGTCGAAGATCCTATGTCGACGACATGTTAAT
ACGAGCTACGTCGTAAAAATGCCTGAGTGAGAAAGTGAAGAGATTATTGAAGGTGTACGATAAGTAGAACTTGTCGATCAGTTTGTCCAAAAGTTTCTGT
GGACGTCGGAAGGTGGAATGCCAAGGACATCAAATCTCGCTTGCAGATTTGGAAGCTAAGGCGAAAGATTTGGGATCTTTGGTGAGCAACCCGTTTCCTC
GGGCGCTGCTATCGATACAGTCATTTTTGGAAGTCTCAACTATTACAGTCGATTTATTGAAGATTTTGCGATTTACGCCTCAGTGTTGTACGAGCTGCGT
GAAGCAGATTTCTATGAGATCAGCCGC