Description :
From Genome Similarity Track
Location :
Scaffold_40:268358- 276892
Transcript NameFunction/comments
Phyca_LT15349646DNA ligase putative

Sequence
8534 bases(100 bases per row)
cctcgttgtcgcggttggaacttccgatgtccttgctcggtcagaagcttgacgccaatgataagctgcactaattgagctcgagtgcaagctgcaacca
ccttttcctgcgcacttttctgctggtgttgtatccggattgtctccactgtcttctggttacggtggtgactagtacgttggtgtagcaagttggaggc
ctttatagaggcaatttctcgtatcttagcctcattgctgcttcgatgcttcagtttttcctcctctaactcacgcgctgccaacattgtgatacccgct
tgttccttcttaagccttgaaagccgcatctgtcctgatacccacgatgttatgtagtgcatactggcttcgactcggctctgctccaaaacctctgctg
ctcgtcgcctctcctcctctttttccaacactaattggtccttagcagctcgtaagttctcagatcgcgcttccatgtcgtttaagcgttgctgaagctc
aaaagcagttgttacagctgtacgccgctgttctcgttgctcttcacaagccataagttcgatctcagtcttctctgcttgaattcggacttgttccaac
accaaccgccgtcgctccttgtctgctcttctgcatagcgtcctggagtcaataaaagctttgattttctgtcttgcatggcgttcttggtcaattcttt
ctcttgctagatgcgcttgaattacttcacggtgcgtcgtgtcagcttttacagcttcttgtgcgaggcgatcaagctttctctctaggactcgcgcttg
ggtacggctttgactgatacgtttttgcgtctcaaaatctcgctgttgcttcgtcaacagctcgtcttgaagtctgacctgatactgctgcttctgcgct
tcagctctgtgcagcattttatgaagatgacacactctgaagaacatttgaagcttcagcgcagccaatcttcgtcgtcgtacctcaactgcttgctgtt
gctgttgaactacgcgatcatggtgcgataatagtcgcaaccgttcctcttctgcagccttccacttccgatcgagctctgctaacctcgcgtccatgtc
ggcaatcatctcctttttatgctttgaactcaccttcatactcctctccacatctcgcttggccttagtccactttaactgctctttgaataaaatgttc
ttcgccatctcttgagcagcttttaatctccgtcgaagcaagatttccttgaggaatttttgaatttccctcaaagctcgagctcttcgttcgcgttctc
gagaaagtttgtctagacgctgcttcttcttcttgatacgataacgctgctgtctccaccaccgcacaaccttctccttcgcgtgctcacgtcggcatcg
tcgtttcaaaatacccacgtagaacttcgcccggtaaaacgccatgtgaatagtacggaaattacatttacggacggaaacatctcttttgtaccgataa
atcgtccagtttcgttgtattcgagatgctgcgtgaaatcttcggtcattttcttcctttatccgggcttgcagacgtcgccaatggtgaaaaaccacaa
actgtctgactttccgccttgccactagtctacggacaaccactttcgctcgtttatgatccacaacccataccttccaccacgcgaaattccgccgtaa
catcttcaactcgcgctccaaaaacttagggccactgtcggtcttcactggggaagtgtaacccatcaggaatgaataaggttgagaaaacgattggatt
tggtgctcgacttctctctgggaaacccaatggctcatgccaaatgcagttccttgaatatctcgacagagctcaaagattctgttaaattcaggttgcc
cactttcatcgtccccctgatagctcgaagcaacggagatggtactacgggttgaagcaggaactgaatgctccatttccaggtttgctacgattggaat
ttcgctaagcatctcttcgttgcagtttgtcaccggaacattacgagaaggaactggagataacttctccgacctagcactggtcgtaggatgatccaag
ctaagaaatgaaggcggtacgggaaatatcgtctggtctgtcatgtttcccaagccattgctgcgcgtagacgcaggtgctccgtagtccaatgcctcct
ccatgaacagttcactagctccagtggaaggttcttccagtcgagcgattatagaccggaaggtgctgattctgggagatctcacttccataggagtttc
cagctcctggtcttccggggcagagaaaatatcatctctcgacacaccaggcaacagactcaaagccatagcaatattcgaaatagctgaagtcgacgag
taggagaactcatcttctagcggagggacctcttcgccttgttcagcgctttctggttcaattttaacgtcctccattgacgcatcattctccagtagca
tttgtataggagtggatacttgaacattgttggtaagatccgtcagaagttcctgcgtccttgtcggtacgagactcgccgtttcaataggagatatact
ttccccaggcttcaaaatgtcatctactaaagcagattctggtgtcgacagcgataaattaggaagcatttgcaacgccttggcgatactggacagcact
tcattggacgagtactcaaagtcgcactcgtacatgtcctcgctgtcttgttcggtctgatttgcagtcgttggaccatccaaagcgcaaccatcgcctt
ccattgcagcacgagatagaactaacggttgtaccagtgacggcacgagaaaagctggttccacaccgttcaaaactagaagatcatcagaccttacaga
tgacagatcctcaaccagctccagagactcggagatgtttacctcttgcatcaacgttggagtttttggagaagcatccgttgtatcgatctcacgttga
gaaatgggcttctggcagtactatcacgcacttgggccccttcatcttgccttgaacgagcagaaatacttatcgttgatctgtgcgttgtctgtgttgc
atttgctgttgttgtgcttggttggctcgtttgaattcccgaaaatgcatttttctcttcagtgacagagtcgtagcgaacttcggcgtacaatgatcgt
gttgaagtacatgttgtcgacctgttcgttgtctgtgagattcccactgtcattgtatttcgctgggtcatttgaattccaacatcgacagcgtcttctg
aagtatcccgtacactcatctggaccccaacatcaaccaccgggttgtgattcgccttagcactgctgctcttctttttcgataccgttcgttcggtaga
gttgtctctgctagatgacttcgctgctgccgtcataccatccacagttacaggcagctccagttgcgtgtgtacttcattctcaacatcagccctagac
atttttcttgtagtcgatggtagggacgaaccagaaggttccacaaacgtattcactcgttcagatacaagatcggttgggcctgttgctggtatccatg
cttgcgacggtaacgatgatttcctagtttcttgtgatgatagtcctctagcttctttggatacacttggtaacattcgagcacaatctcccgaagtttg
agctagcgatggaagactggacacagcagcccccaaaactctggaagatggcgacttgatgtccattgaggatttcactgttggagagccagcccaagct
tccatgacagatatgccacccgacagttcatcacctgagcgagataattgcgtgtcttggcgacccaatctttgtgcaatttcacctccaaaagtgccgt
agttaccttccagatcatggcgttgttgaattggtcgattcaagtgcctcctgtaaccactgtgagattgaagatatcttggcagcatttgcacagcatt
aaaccgagtctcaagatccatcagatgcagtaaagccgctgccacacgctctgccggtaaaatttgccacccagggaaatatcgctgcgtttggagtgag
aatgtttcgagcttatgcgtcaacaatcgcataagcgatgacgatgacgacgaagcagaaccaaataatacatcggacgatgcgttttggtgacaagaac
acaacagaacctccgacgagtccaacgataatccatccacgaaagggttacgaatcaagttcacttcaaagtcctcaaaaaatcgttgcagtggcggtga
acatgcgacgaagtctgtatcggatgaagccatttgcagtaggtatccgtaaaaatcccgctccagaatgtcatgctcaacactagcgccaatcatgtta
gctcccagttcattactcaggtacaccacggcttccaccactgcgagcgacagactgcgcatccggttaagcagttttaccactcgttgtggcacgttct
tttccgcatgagacgctcggtgcaacggcaacacccccatgagttcctgctgcaaatgagccataacttggtcgcgcaagtgtatgttttgctggaccga
ctcaatcacaataccagcaggtgtctgttgtaacgatgatgaacgcgtcgctcggtgcaatgaaccagtgctagcactgtgtggagaacgctgatgatgg
cgctgagatggcggatcgtttcgcgtgcctaatacttcctgcttcaacttgtatgggcttgaaagacgtctagcgtgaagctgttgcatctggcgctccg
taaggggcttgtctcgagggtgccttgatggcactgactgctttggttcaacagtgtaatgatgcccattgctacggcgccgactgtaacgtgtatcacc
agcgctgattgatctcctttcacctaggtgcaatacgttattctccattcccagtcgctgagagttttgatacaacgaatcgtccagctccagttccact
aggagacgctgttggtcatggcgtcgacgtcctccggtctccgttgctcggtgcattgaagtacttccaccaccccaaaagaaagttcgctcagccatag
ccttaaaataagtcgacactttccaaatgctttttcaactggacacccatcgcctgggacgttgcttaaaagcgtttcgttcccagaaaatctgctccta
aacagacaacaacaaataaacgagatactgagctctggcgctaagagtcgatgagcccctttgttaagatttccaatggtaacccaattattccatttgt
acctagatcaacatgtcgtcgtcctcttcctcgtcgccgttggttacggtggtgaggccctgtgctcgatacagatcggcgatctggagcaatcaataat
agggcaatttagtgaattagtatgtcatcaagtaagcagtgcaacgcgatttctattcgtacctgagcagagtttgtcgcctgcgtcgtctctttgtcgt
cgcggatgcgaatgaaccgagggaaacgaagtgaaatgcccttgtccttggcaacaagacctatggctgctgtgtactttggcgatatcgataggtcagc
acctagaatctcccacacacaactggcttcaaaccaaacatcaggcttgattccttccccgacagcatagtcacttggcggcttgtctaccaccttctcc
ttaagctggtcgtaaaattgcttcagtacttcatcagatagaccagtaccgagcttcgtgatgggttggtacatctctgtgtccgggtcatagcatgcca
gcaaataggccccatacaccccagtacgcttgccgcggccgtggaatgcgccaatcgggaccaagtctgcagaatcaccaataccatccaagtaatcctt
cttcagcttcagccacttgtgagatcggttggctggctcatatgttgcttccttttcgagcgttttcaccattaaaccttcacagttttcgcgtacagcc
tcttcgaggaaattccgaaccttgtccacagcctcttccatagcctcagggttgtccttcacatccacaccatcctcaacatccaaagatgtagcgaact
caaagtttcccggcttcacttcgaacatctcgcgcagcttctcacggcgttgggctagtggggtgcttaggaatgattcaccatttaggaatagcaaatc
aaaagcatagatacatacaggaaccttaatatcttccactttcacattctgcaatcaccacaaccacagtaacagattaggaatacaaatagtatgaatt
aattccgagtcttcttgcaacgtacctttcgagaacgcgtactcagaatctggaaaggcagacgtttgttagtggcacgatcaacagcaactacctccgc
atcaacgatacagctctggacaacgccctccttggcagcttccgatatggccagcttgacgtcagggaatctctcagtagagttttcgaaattgcgcgag
aatatagccatctctccgtttggaagaatgtggatctgagcgcgttcaccatcgtacttgtactcgcacgtaaatggcttgccttcgaagcgatcaaaca
ccatcgcgtatgcctttgtcgggcgagcaagcataggagacactggtgtgccaggtgtcagcacacacttctcagctaccttcgcgaaatcctttactcg
gagaaaaggagcacttggaacctccttctggacatcgtagaaagctgctacgagtgcattgtagctggggcattcagcaaatgccttcttgacgaaggcg
agcgtctcctgttgcttgtccttgtctttatagtccttgtccgtcataaacgcgtacgtcaaccccatcaggatggacttttcagccaacccaattcgaa
gcttaccctggagtccacgaataatatacttggctccttcagcagattgagcacctttgtctttcttctccttctcgcacttcactagcaaacccttgat
gatggagcacttctgctgctgtgaattgtttccggtcatcttagcaattttaacgaactggttgtacacatgctgcacggtgagtccactgccttttgaa
gtcgcaggtttgagagacgcgaacgatagcgtcttttgctttgatcgggcattctgcgcaaccttgccaagatcaccttccttgtggtacatctccttga
tgaacttaaggtttgctcctgttgcctcaccgatggctttcatcagaatagcgtcaccaatgccaatcttcaggttctcgaacggcggagcgaggtcgac
acacacacagaggtagatgcaggccagcaaatcgtccggtgaacgacggatgacattgcgaaagaatgccgtcagcaagtcctgaattacgagacggccg
gtaacctcttcaatcttagcgaacaaatgcgccagatcaaagtacgggatttccttaggtccatcgccatcctcctgcttctcagccgcctttttcggct
cctcattttgggtcttgacttccttcttcttctcgtcagctagggttggcttagtcttgctcttcttactcgagactggagagaagaaacccgcagcagg
agtcacagcctttttcttcgtctccgtcttctcagcctccgccttcgccttaagttccttcttcgcctccgtcttaacttcctctttagtatcagttttg
gacttggcttcttcaatgtcttcatccccttcggactcctccttctgagctgggctagaaattttcttcacttgtttcttgggacttttggccactttaa
ttggtgatacggtcttcttgggactcttggtgtctttaatcggtgttgcagccttcttcttggtactcttgaccttctcaggggtcgaagttggggatgt
aatgtcaatcacttcctctttcttgttcatgggaagatccaaatcgctgtcttcgtcgtcctcttccacaacccgttgacgcaatcgacgacgaccagct
gcagcacacacacaacatacacatcgttacattaactggtaaagtcatgatcaatcctaagcagacgtacgcttcgtcctgctccggacttcttcctcct
ccatgtcaacatcctccggttcctcctccacctgttcttccttatcctcttcaacatccttctctttcttctcctctttagacttctccttttccacttc
ctcaacttcttctactttttcctccactttagtcttcttcacaggttccgctttctgatcatcttctgcaggtttcctcttcttgggtggcttcgcactg
aagaatgacctgataaccagcaggaagagcgtcaactacaacagcagcttaacctaaactagaagaggagactctacgtactcaattgtgctctgcatag
gcgcagctttcctccccataactcaacccgcaaccggttcacaaaatggagccaaaaaaggttggcgccaaacatttcttgatttttcgaattttggcaa
tttttggcatttttggcgggaaccatcattctct