Description :
From Genome Similarity Track
Location :
Scaffold_346:26828- 27830
Transcript NameFunction/comments
g12866.t1OWZ07043.1 hypothetical protein PHMEG_00020617 [Phytophthora megakarya

Sequence
1002 bases(100 bases per row)
ACGAGCATTATCGGTGCCCTTTCAGAAGTGAGCATACCTTGCAGGCTCTTGTGCGTCTCTTCCTTCCTACTCCATTGTTACCGGGGCGCCATTCATCATT
CTGCAGAGGCTTGTGGGCAGACCGTCGGATCCTGCTGCTGTTTGCTGTCTTCTGTGGCGTCACTTGAAGATTCTCGTTGCTTCGTAGCAGATCCCAGTCT
TCTTCACGGAGCTAACACAGTTCCAGATGAAGCTGCTTCATGAACTTCACATGGCGAACCTTGGAGAGATTTGCGGCTGCGCGCCGAGCGTTGTAGACAA
TGTAGGCGTTGATAATGGCTAGATCTGTGAGTCCAAGAAACAAGGACTTGTAGTACTTCTTGTACTTGATGCAAAGCTGCAGCGAGTACCTGTTGTGACA
CGTGGCGACTGGACGTAAAATGTCCGAGCGTCGTTTCCCATTTCCCATGGAAGTACTCGCGGTGATGATTGGTCCAGAAGTGCACGCAACATGGAAGAAC
GAGGACGAACGGAGAACTGGTACAAGTTCCCACAGCATACTGAGACCAAGTGACTTCCAGAAGTCCTCCCAATGTCGAGTTACTTCCGGAAGTCACGTGT
GCCTTCCGAAAGTTCCTTCCTGATGTGACTCGCAGATGACCCAGACGTTGTGGGTGCGGAGGCTGACCAGACGCCCCTGATTTGTACCCACCAAGACCTT
TCCAATTTTCCAGTATACAAAGCCCAATATATTAGCGACCGACCAAGACGACCAGCCGGATATGTTATGCACGAAGAGCCGGCTTGCGACCAGGATGTGT
CAGCCTCCCGGATGCTGATTACGCCAAAGGAACCCTATAGTGAAACCAAGACAAATGTGCATGTGGAAGACTTCCAGCAGAGACCTTGACAGAAGACTTC
TAGCAGAGACTAAAAATAACAGAGAGTTCGTTTTGCCACCAAGGGCGCAAGTGTTTTCCAGGGCCCTTATCAGTTGGCCTGGAAGCACGCTGGGATAACG
CC