Description :
From Genome Similarity Track
Location :
scaffold_48:268277- 277511
Transcript NameFunction/comments
g7489.t1hypothetical protein
g7490.t1 hypothetical protein PHYSODRAFT_495212
g7491.t1 hypothetical protein PHYSODRAFT_491292
g7492.t1 hypothetical protein PHYSODRAFT_259733

Sequence
9234 bases(100 bases per row)
TCTCGCCCGAACAAGCGAACCGAGGAATGGCGAGAGCGACTGCAACGCGCACGCGCACGCGTGCCGCCAAGGCGCCCGCCGCGGAAAAGAAGCGTCGCCG
GGCGCCGTCGGACTCTTCCTCCGACGATGAGCAGGAGCTTGAACTGAGTGACACGCGCCGCGGCCGGGGCAAGCGGCAGAAGGCCAGCGCCATCCTGACC
GAGTTCACGAGTCTGGACGCGCTGCTGAGCAACGACCTGGCGGAGAAGCGCAAGCGCCAGAACCGCGAGCGCAAGCTGCAGAAGCTGCGCGAGGAGAGCG
AGGCTGCGGCCAGAGACGCGTCCGAGGGCGGCTCCTCGCCGCTGGGGAAGCTCATGAGCCACATGGCCAGCAACATGTCCACGCTCTCGGGCGACAGCCA
CCTGTTCTTGGGCTCGGAGGTGACGGTAGCCGAAGAGAAGTTCGGCTACGTATTTACGCCCATTACAGAGGTGGGTGGGGGCACTGAAGGGCTCGTGACG
GGATGATGTATTGACAAAAAGTGTTTTTTACGGAGTAGCCTCTGCCGTATCGCACGTACAAGGCGACGGAGACGGAGCTCAAGAGCGACCTTAAGCTCGT
GTACGCGGTCATGCAATCCACGGACGACGCAGAGCTGAGCGGACTGCTGTGGTCCAAAGCCATTTTGATCCGCTGCATGCTCACGCAGCCGACTAAATCG
ACCACCAGAACTGCTGCACCACCGACACCGGTGGCGCTGCCATCAAAGATAGGATCGTGGTTATTTATGACGAGTAGGCTTGTTGTGATGCCCGTGAGAA
GGAAATGTCGGCTGCCGGCTCTAACGAGTGCTCCTTGATTTGCTTGTGCAGTGTCGACGCATAGCGACAGTCACGTGGTTAGTGGATGCTTTAGCAATCT
CTTTCTGATGCTGAGCTCGGTCAACAAGGCGTCCATTCCGAGATTGAGCGCAGCTCTACCCGTTGCGTGTTTTGCCCACCCAATTGAGGATTTCCGCTCG
GCTTTTGGCACCCAGGTCCCAGCAATTGAAATGGAGTGGAAGCCGACCATCTACGATTTCCTCAATGCCTTCCGCGCGTATGGTTTTCAAGACAGTAAGC
GATCCATGAGTGTGAAAAGCAAGATCCCGGCGACCCCGCCGTCGACGAAGAAATTGCGCGTACTGCCTTTCCCGACCCTCAATATGCATTACGTGCTGAT
GTACTTGGTGATCTGTTTGCGCACGAAAACACTGACGCTGGAGGGCTACGATGCCTTCAGTTTCACGATGTTTTTTTTGCGTATGCAGTTTGAAAACGAT
ATCCACGCCAGTATTGTAGACCTGGCCACCATTTGCATTGAAGAACTCCTGGATGTGTTCCCGCGCGCCGAGTGGCGGAGAGAGTGGGCGCCGCAGCTTG
TTCTCCGCATCGCTGGGGCCAACGAAGGCTTGTTTGACTCGGCAGCTGGCTGGCTCGCAGTTGCACGTCGACTTCCGCGCACAATGCGTGGCACACAACT
CACCACAGGACTGTCGATCTACGTCCTGCAGCACCGAATCGACATAAAGCTACTGGAGGGGGTACGCTAGATTGTGCTCCTGGTACCCTGTTGTGTGTCG
CAGTCGCTAATGTTGATTTTTATGATCGTTTTGGATATACAGGCAACGTCCGAGAGGCCGTTAAAGTTTCCGATCCAGAGTGGACTTGTGGTGGACATCG
TTGCTGGTATTGTGCAAGATTTGACACTGAAGTATGCGGAAACGCGCAAGAACGGCAAGTTATCGAAAACCACGCCGCCGTTTGATCTGCTGTGCAAGAA
GGTGGCCCTGATGGACCTTGCACTACAGGCATTCCTCAACATCCTCACACCAAAAGAAATGAAAATCATGCTGAACAAGCTGGACCAGCTGGCTGACGCA
CACAAATCGACCATGTCAGCCAAGTGGCACGAGCTCAAGACACTTGTAAGTCTCATGCACCGCAAGTACTCGCTTGAAAATTTGCGCATAGGTCGGAGTT
CTGCTCCTTCAGCGAAAACCGAGCTGTTTTGTGACGACGACGATGAGTAACAACATTTAGGGACGTTTGTTGAGTCGCAATGCGGCTGAATAGAGATTAA
CTGAGCACTGGAGCTTGTTATCGCCCTATGCGCGGTCGCACCGTGCGAGCTAGTGGCGCTGCGGTTTTTATCTTAGTATGCTGCCTCAATTGTGCGATCA
CCTACAAACTCATCAAACTATTGCTGCTCTTGGACCAGTGCTGCGTACTGCTTCTGCAATTTGACCTCGATTAGCTGTTGCGAGTTCACTTCGTTTGCCA
GTCGGGACATACGGCTTTGCAGCGCCTGGGCTTCGACACTTGCCAGATCCTCGAAGCACGCCTGCTCGATCGTAGCGTTCTGAAGCTCAGTCATGTGGCT
GCGCAATGACTGCAAACCCTGTTCCGAGCGGCGGTAAAATCCACCATTTACGACCCGCGCCCGCTCGCCCAGCTTCTGCGCTCGCTTGGCAAGGAACTGC
TCGGTTTCCTTCAACTCCGCAAAGCGAGCTCGCACGGCATGCAACTTGTCCTCGTCTGATGTAGCAAATTGGAACGACACACCACCGTTTGTACCTTCGC
CGTCAGCTTTGCGTAAATAACGCGCTTGCACTTCCTCCCATTTAGCGCCGAGAATCGAGGCGTCCTGAGATTTCCACACGTTGTTCACGCCACACAGACT
GGCCTCGATCTGCACCATTTGCCGCGCGTGCTCCATATCACTGTCCGAGAACTGCTGTAAATGCGGCACTGCCACTGCGCTCGGAGATTTTTTGCGCTTC
TTGCTCTTCTTGGACTTGCCATCATCTATGGGATACTTGGCACGATCATGCTCAAGCATTCGGTACATTTCGTCCGCTACCTCGGTTATTGCGCTGTGAA
TCAACACCTTTTTCACCTTTGTAGGACGAGGAAGATCCTTTTGCACAGCAGATGAACGCCGTTTAAGTTCACGCTCTTTTTCCTGCTCGCGCTGCTGCTG
CTCACGAGCCTCTCGCTCCCCAGCATCTTCCTCCTGAAGGCCAGTGACGCGGTCATCGTCAGCTTCCTCCTTCTCCGGAACATTAATTTCATATTCATTC
TGAGGCGCGGGTAAGCTGTTGAAACCTTGACGCAGACTGGCTGCCAGTCGCTTTGCCCGAGCCTTTTCTGCCTTGGTATTCTCAGCCTCTGTACCATAGA
GTTGCTCCGGGTTGATGCCTAACTCATCACGCAGTGGTGTGCGTGTGGCAGACAGAGGCGTCTTGTCACCGACTCCACCAGCCATTGCTGAGGATGGTGT
CCGGGACGGAGTAGCACCCGCATAGCCTGTTCCTTCGTAAAGCTCAACATTCTCGCCGCCAAGAAGAGGAGTAGCACTGTTTCGCATGGCCAGCAGATTG
GCGGTTTCCTGCATAATATTATCGTGCACGTCGCGACTTGATGGCGTAGCTGCAGGGCCTCCAGTAGCGGGATGAAGCGGGGTGGCACTGTAGTCACCCA
TAAGCGAACGCGTCTCGGTAGCTGATCCGTTCTCCAACGCAAGCGCAGCTGCATGGGTAGCGTGCATCCCCAACTTAGCGAGGTCGCTCAGCTCCTCGTT
CGAAACCACAGGTGCGGGCAGCTCCAGCGGAGTGCGCTTAATCGCGTTGATGGGGTCGTTCTTCTCGTTCACCGCAGCGATAATCTGTGGCAGGTTGGAT
TTCATCAGCGATTTTTGTCTCTTGGCATCCTGTTTGCGCTCCTTCTTCTCTTGAGCGTCACGGCGCACGCCTTCCAGCTTGTCCAGCTGCAGTGCCGCCC
GCTTCGGGTCCAGGCCATTGCTGGAGATGCGCTTCTCCTCCGCGACATCGTAAAACCCAGCGGGGGCCTTCTTCTCGAATGGGATCTCGCTCGCGTAGTC
AATGTACTTGCGCTTCTTCATGTGCACCTTCGGGTTGGACGACATGACTCCGGCAGCCTTGAGTTCGCGCTTCTTCTGCAGCGTAGCGAGGCGTCGTGCC
TCCTCCAGCTGTTTCTCGCGGGCCTTGCGCTTGGCCTTCTTGCCCTTGGTGTTGGCCAACCGAGCCCTCGCCTCCGACAGCATCTCCTTCTCGTCTTCGT
CCATGTCCACAGGATCGGGTCTGGCCGGTTTGTTCTCCGGATTGGGGTCGATCTCCCCGGCGCGCAACCGCCGCGGGTCGTCGCTCACGTCGACGCCGTC
TTTGTGTTGCGCGGCGTCCAGCAGCCGCTCGTAGTGCTCCATGCACTGCGCCGCGGTGCGGCCCACGATGGGGGCGATGGTGCGCCACTGGGAGGGCATG
AGTTTGACCAGATGCAACAGCTTCTCCTCCTCCTCACGGCTCCACTCGGTCTTCCGGATGCTTGGGTCCAGCCACTCGTACCAGCGCGCCTTGCACTGCT
TAGCCGACTTGCGCGACAGCAGCGACGCCACGCGCGCCCACTGGTTCATGCCGTACTTCATGACGGCCGCCTTGAGGATCTCATCCTCCGTGTTCTTCCA
CACGCCGCCCTTGATCATGATCCGCATGGCTGCCTGCGGGGGGAGGCAGCGACAGCGACGGATAATGGAGCGAAACGAGTGGTGTGCGACACATCACATC
GTATCGTGTATAGTTGATGTGGTACGTATCTTTTCGTATTGAAGTTGTCATGGCGACGATGGAGCAGCGAGGGCGCAGTCTGCAGGCGGCGCTGCAGTTC
ATGGAGCGCAATGGACGCGCGCTGGAGGAGCTGGTGGCTAGGATGTTGAAGGCACGTGAGGAGCAGGAGACCTTCCTGGGCGCGTTCGCCAAGAGTCTGG
AGGATATCGCGGCCCAGGAGGAGTGCACGCCGCTGGCGCAGGTACTGGAGAGTCTGGGCGACTGTGGGCAGAAGCTGGCGAGCGAGAGCCACGACATTAT
GATGCTGCGACCCGAGACGGAGATTTTACAGGTGGTCACGCAGATTCAGGACTGGGCTATTGTGCCCATGAAGGTGCGGGGCCTGAAGAGCTCGAAGGAG
GGTAGAAGAGAGAGAGAGAGAGAGAGAGGGGTCTGACACTTTGGACTACTGCAGAGACTGCTGGAAGACCGGGAGAAGGCAATCAAGATTGAAGCCAAAC
TACAGAAGGAGTATGACGAGATGAGAGTATGTGGGAGAGCTGTGGAGACAACGGTAATGCAGGTCAGACACTAATGTATTGGTGTCTTTGTCCTGGTTGA
AGCGAGGAAGCTCGGCAAGAGAGAAGAAGCTGCGGATGCTATCGGACCAGAAACGGCGAGTAGAGAATGTCAACGCACTGCTGGAGACACACATGGAGAG
CTTCGACCGGTATCGAATTCAAAAGATGAAAGTGCGTTTGGTATCGCCTCTCAGCTACCGCTCTCGCTAACCTGCTAACCACTCTAAAATCTACTACTTC
GCAGAAAATTGTGAGCGAGTTGGCTCGCTCTCAGGTATTCTACCATGCCAAAGGACTGGAGTTATTTGCCGTTCCGTGTCAAACCATCGCTAAGCTCGAT
CCCTTAGACGCAATGAAGGCCACTGCACAATCCAACTCTACCGATGCTACCTAGATGGGTCGGACAAGCAGAACTTTGGTAGCATCTCGGTACCAATCGT
AAGCATTTCATTACCTGTATTATCCTTGTCTTGCTAATCGAATATGTACAGCGCGACGTAGCTAGATTGCTGAGGAGCGGCCTCTTTCTCGCTCCTTTCT
GCGCTTGCTGTGGCCGAGCTTCGCCATGCTCTCTTGCAACTTTCGCCAAAACGACCCCCTCTCGCTTGGTGTTCGCTGTGGGCTCTCCGTGCCAATACCA
AATTGTTGGCGCCGTGAGATTCCAGGCGATGCTGTCCAACTTTGCGGAGAATAGCAGTAGTCCTCCAGCAGCTTGTCGCTGTAGAAACCTCGTTTCTGCG
TCATGAAGTGTTTGATCAGTCAGGAGTACATAATTCCACAAGCACAAGTCGGTCACGCACCTCTTCGAATTTCTCGTAAACCAAGTGCACAGGCACATCT
AAGTAATTCGCCAGTCCGAGCTGCAAGCTGCAAAGTACGCATGCAAAGCATATTGTTAGCTGTTGTACCGATCCAATTGCACCCAGATCAGCCTGGCGGA
TACCTCATTTGCACCGGCTGAAGAGATATTTGTCGTCGAGAAAACGTGGGGGTCGCTTGGGACACAAAGGATACACCGTAGTCCGACTGCATTTTAAACA
GTCAAATTGATGAGCCCGCCTGGAATTCCACTCCCAACATATACCCACGTCCCATCAAACTGACCTGTGGCTGGTGCGAGAACTTCACGGAGTGCTCGTA
CATGTGTCGATAGACAGCATCTCCTAAAGATTCAAGCTCGCTGCCGCGTTCCTCGCAAAGTTGCACTCTATCAATGAACGATGTCCACTGTTGAAGACAA
AGTGTACGTTACAAAGTGCGACGTCACAAAGACCCATACCGGGGTACCCGGTTTGATACTACCACAGCAAGTTTCATTCTGCACGCACCTCGGCGAGAGT
TTCTTCAGCGGTGTATTTGCGAATAAATGGATGTTGGAGCAACGCTTCAGCTGACGGTCTGTCGTCTGGGTCAATCGTAAGGCACTACACTCATACCCAA
TGGGTACCAGTCAGTATACACACCAAGCACAAGGCTTGCAAAAATGAACGAACCTGATCGGTGAACGAGCGGCATTCTTCAGAGTATGCTTCAGCCGGCA
ACTTCAGGCATTGTTCGTTTGCAACCTGAAAGGGTGTCAGTCTATGTTGTGAGTACGCAAGTAGGAAAAGAAGGCTGGACTAAAGAGAAAACTCACGGAA
TCAACCAAGCCGAAAAATCCGTCCTGCGTCGGAAGCGGATAGCGGCCCAGAGCAACAGATATTAAGGCGAGTCCAAAAGACCAAACATCGGCTACAAAAA
CAACAACAAGACAGAAAATTCGTGAGCACGCTGTGACTAGGGGCCACATCCCACGCACGACTCACCAGGATAAGAGTAATCACCGCCACCTATCCGCTCG
GGTGCCATGTAAAGTAGAGTACCCACAAATGTCTTCGTTGTGGTGGAGGAATCATTCAGCGTACGAGCCAAACCAAAGTCCGAAATTTTGACATCGCCTT
CTCGGTTTGTCAGCAAATTGTGCGGCTTAATGTCGCGGTGTACCATCCGCTTGTTGTGAATATGAGCTAACCCATGTAAGACGCCCGACGCCAAGCGTGC
TAGAACCTTTTCGTTTTGGCAGCCACCACGCAGAACAATATCTTGCAGTGACCCCGTGCTCATGTACTCCATAACCATGCAAATTGAGTTTTTTGGGCGA
TCGACAAACGCATCGTAAAATGACACGATGTAAGGGCTGGGCCTGGAATATATAAAATAACAAAGCCCTGTTAGTAAAACACGCACAAGCGTATTCTGGG
GAAAGCAAGCATATTCGCCAGGTAAGACGCATACTTCGCCTTGGGCTTGTTGGGGCTGTTTCCGGGGGTATCGTGATACGGCATGGGGCTGTCGTTACTT
CCCATGGGAACCAGATTAGAGTACAATGCATGCAGCTCGCGCACCATTTGCCGGCGTTGCCCTCGTCCGTACACAGGAACATCCTGTATCCCATATTTAC
AATATAAGCACAAAGTGGATTTAGCAACAAGACCAACTGTAGGCAGAGCACATCGTAAGAACTCACCTTGACAGCGACCACTTTCAGCGTGGGAATGTGA
ATGGCCTTATAAACTACCCCGGAGGCTCCTCTACCAATTTCTTTAACACGCTCGAGATTTTCTTGCAGATGCAGGCATGCAGCATCCGGTGATGAAATAC
CCGCTTCCGACACTGCCACATTCTTGGTCGTAAACATGCCATGATTCGGTGAATACGCACTCCCAGCACTATGCCGCCCACCATCTACAGTACATCATTA
AATTTAAAGTCAACAGAAGTGAAGCATCAATAGTTAGCAGCGCCCGACTCAAAAGTCACAAATCGCATGCGGACCGCACCGTTTGGAGATTGAAGGTCCG
ACTCTGAGCCGGAACTGAAATTTAGTTTCATCATCGCCTGCTGTGCGGCGCTAGGGCCACTCACAGGAGTATTCGATCCCGACGCAGCTGCAGCAGCAAT
TGCAGCTGCCTCCATAGCATCTCGTTTCGCAATAAGCCTAGTAGCTGCTCGCTGAGCCCGCTCCTCCGCTTGCTGGGGTGTGGGCATATCTTCAAGTTTG
AGTCGAAGCTGGGGCCGCTTGCCTGCACGGGCACTACCTGGGGTCCTCTTAGCAGACTCTACGGTTTTCCATTGCGGTGAGCTATCGCGAGGAGTAGATA
CTGGTGGCGGTGTACCTGTGGACGAAGGCGATTGCGCCTGTTTTACCGGCGACAGTGGTTGAGGCCGTTTATCTTCGAGAGTGAGTTGGTTCGCTAGCGC
ATCAATTTCTTTGTCCAGTTCGGTCACAGTATGGTCGGCATTCTTCTCCGTAGCAGCACCATTAGTCTGATGGTAGCCAATGCTACGAGCCGATTTCGGC
GCTGGAACGGAAGCATCGCCGCGTGGACGAGCAGATGCCGATGTGATTTTTGCAGCCTGCGAGAGCGATTCCCCTTTGTGCGGCTGCTCCAGCAACTCGG
TCGTCTCCAGAGAAACCAGAAAATCCTTGTCCATCCACGGACACTCCCACGACTTGACCTCTGCAATCCGCAGTTCTCGCGGGCAAATATCCGGGAAAAT
GCGTGCGATCACCTCGTCGTCCGCCTATCAACAGAGCAACAAGACACCACATAAGTCCACATCTCCTCAGTAGCTGAACATTCTCCTCCGGCACCTGCTT
GGTGAGACTCGGCGCCGATTGCGGTCGCATCAGCGTGTTCTTGTGCACGAGGAATGTCGCATGGTGCGGCGCCCGACCCGCCCGCAGCAGGATGGGACTG
GCGCCGTCCGCTGTGTTGGCGAAGGGTGAGCTGTTGGATTGCAGAGTCGTGTTGGCGGCCGCCCGCTCGCGACTCTCACGGCCCTCGTAGTTGGCGCTCT
CCACGCGGCCGCGCTTGCGGAATCTCTCGAGGAGCGTCTGGCGCGAGACCTCCTCGATGGAGCCGCTCAGCAGGTCGCGGCGGTGGCTGGAGGAGCTGCT
GCTGCTGGAGGCCGCTGACGGAGGCGACGTCTCGCGCTGCGCCGCGGGCTTGGACACGTGCCGGTTCTTCTTCATCGTGAGCTGCTCCGGCATTTGACTT
GCTGCTTACGATCAAGCCCAGGAAGTGTATCCCC