Description :
From Genome Similarity Track
Location :
Scaffold_5:268271- 269404
Transcript NameFunction/comments
Physo_128576ABC transporter family protein

Sequence
1133 bases(100 bases per row)
AGCGCGGTGAGTGCTTCGGCTTCCTCGGTATCAACGGAGCCGGCAAAACCACAACGATGAAGATGCTCACGGGTGACGTCCAGCCGACACATGGCACAGC
CACGCTCAACGGCTTCGACATCCTCTCGCAGCAGATTGAAGTGCGTCGCCAGATCGGATACTGCCCCCAGTTCGACGCCTTGTTCGACTTGCTCAGCGTC
CGCGAGCACCTGGAGCTCTTCGGTGCGATCAAGGGCATTCCACGAGACTCACTGGAGCGCGTCGTGATGGAGAAGATCCAGCAGCTCAACCTCGGTGACT
TCGAGCACAAGCTCGCTGGCAGTCTCAGTGGCGGCAACAAGCGCAAGCTGTCCGTGGCCATCGCCATGATCGGCAACCCGGCCATCATCTTTCTGGACGA
GCCTTCCACCGGCATGGACCCGGTTAGTCGACGATTTATGTGGGACGTCATCGCGGATATTTCGACTCGCGGCAAGGAGTCGACGATCGTGCTCACCACT
CACAGCATGGAGGAGTGCGAGGCGCTGTGCTCTCGCGTCGGTATCATGGTCGGTGGTCGGCTCCGCTGCTTGGGCAGTGTGCAGCACCTCAAATCTCGGT
TCGGCGATGGCCTCGTGTTCGACGTGAAGCTCGACATGCCGACGGCGGACGAGTTGGAGTATCTGGTCCAGCGCATCTTCGGCACCGACAGCGAATTTGT
CACTCCCATGGAACTGGAAGACAAGTGCCGCGCGTTCGGTAACGCCCAGTTCGCCGAGCGAGTCGATGCTTCTCACCCGACTGGCTACAGTCTGGCCGCC
GCCATGGAGCGCGACGGGTTCGTCCGCGCCGAGGCCTTCTGCTCTTGGTGCGTCGAGGAAACGCGCTTCGACGCGCTGAACGACTACCTTGTACGGGCCT
TCGGATCGGGACAAGTGCAGGTGATGGAGCGCCAGAACGACTTCGCGCGCTTCAAGGTGCGCAGCCACAACAACGAGGTAAAGCTGTCCAAGATGTTCGC
GCTCGTCGAAGATGTCAAGACCAAGATGCACATCCGCGAGTACAGCGTCTCGCAGACGACACTGGAGCAGATCTTCAACTCGTTCGCGAGCCAGCAGGAG
GAGGAGCAGGGCGTCGCTCGCGGTGTTTTCCAG