Description :
From Genome Similarity Track
Location :
Scaffold_159:26826- 29585
Transcript NameFunction/comments
Sapdi_VS20SDRG_16879hypothetical protein

Sequence
2759 bases(100 bases per row)
AATTGGCAATTGAAAGCGTCGGTGCCTGGTTGGTTGAAACGCCTCCTATTTCATCCAATGGGCATCACTGGCCTTTTTTCTGTCAGAGCTTATTTATTGG
CCGTCGTGTCCGATATCAATTCCCACAAATATCTCACTTTGACAGGTTTTTTGGAGTTATTATCGAAGGCCTCCGGAGGCCGTATTTAGTATCGAATTCT
ATTATCGAATATTCTTTTTCACAGTGACCTCTGAGACTCGATCGAGATAATATAATTTTTTCGATAATTTTGAAAATCGCAAACTCACTATTATCCGGAT
TTTTCGATGGGAGGGTGGCCGCGGGCAACAAAAGTTCAGTGGTCCCAGCTATAGCGCCAACTAGGATGGTTTCAATACCNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCTGACGCGCGCCGAGATCGCAGCCAAAGCTCGCGCCCACCAC
CAGGCCAACACCATGTTATATGCCCTACGGCGCTCGTCGTTGAAGCACTCGCGGTCGTCGACGAGCTGCTCGATTGCTACACTACTACTACTTTGACGTG
GCGCTGGTTCATGAGGCGTCGCCAACGTTCTTCACAAGCTAGCCCCTCGATCCCGCAACGCAATGAACGGTGGTCAGTCTATTATATCCTCTCAACCATC
GGGCGATATCGCTGCGAGTTGAAGGACAACTTGTTTGGGACAATTGGCTTACTTGGTGTTCCCGCTCAAGTGAACCGGTTCATGCTTCAACTTGAAAAGT
GGGATTCCGTGCGCGGTCGAGTCGTCTTCAGATCAAAGCGCCAAACGGCTCTGCTCGTTCCACAACGACCAAGCAACCACGGCGGTTTTCAGTGATCTAA
ATTGGCACATGTGCGATGGCCAAGGTGGCTGACACGCAAGCCGCTATCCTAGCAGTCGCTGCGCAGAGACAGCAGTATGCCGTGTGCTGGAGCCGAGCTC
CCTTTCTCCTGAGCCTGATCATGCTACTCAACCTCGTAGCCATGGTACTCACCACACTTGGGCCGCGAACACCCTTTCATACAATTGTTCTAGCCATTGA
AAGCTTACGTGACCGAGTTCTTGCCGTGGACGTACATGCCACCGCCGGCACCACTCGCCTCGACCAACTTTACGCTCTTCAACGCGTCGACACTGGAGCT
TCTTCAAAGACTATACAACCGGAGTACGCTGCCTCTGCATGCGACATACCATGAAGACGCAACGGGGTACGTGCTCCGAAAAACGATCAAACCGCGCATC
ACGAGTCTCGATGCGTGTGCCTCTGAAGTCATTCCGGGCCTGCCCGGCGCGATCTTCTATGGCCCGTCCTTTTCGCGACTAATTTGTGCGATGGCCATGA
CCGAAAATGGCACTGCGTGGGACGGCCGTGGTAGCTGTATGGACCAAACGTTCTTTGCGCAGCCGTGGATCTACCAATGTCTTTGGCTCACGGGCGGCGA
CGACCTTGCACTCAACGCTTCGGCGCCCGGGTATACGCTCACGTACGCAGCCCGTCCGTACCCGATGGCACTATGGTGCTCCGCCAAGTTTGTTTACCGG
GCGATCACAACCGTGTATATCGCGCGACTTGTCTGGACGCGCTACTACGTACACTGCACCGCGCTCGCATCTTCATTGGCCGTCATGGGACACCGACCGT
TTGAGGTCAAAAACTCGGCTTCTCTCTGGCGCTATGAGGTTGTGCTGGGGGACCCCACGGCGATGGTGCTAACAGACCCTCTTGTCGCCTTCTTGCTTTG
TGTCGACATTGGCGCGAGCTACGACACATTGACGTTCGCTGTGCTTCGAGCCTCGCAGAGCGCAGACATTTATGTCATGTTGATTGCATTTCTGTACCTC
TCTCGCACCGTACGTCCCCCGCTTTTACTGTCAAGATGGTCAGTAAATGAAAATGGATATTGTAGGTCTGGGTGCCGTACTTGGCCGTCGCGACGACGAC
GCTCGTCGTGAAGCGGTACCACAAGGAACACACGTTTGCTCAAATCGACCCGACGGCGCTGGCCATTGAAACAGCGATGTATGGGCCGGCGCTCACGTGG
TGCATGGGCAACGTCTCTATCCTCTTGCAGTTGTACCAGTACCTCGGTCGCGCTGTGGT