Description :
From Genome Similarity Track
Location :
Scaffold_1059:2681- 4428
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1059-fgenesh-gene-0.0Protoporphyrinogen oxidase

Sequence
1747 bases(100 bases per row)
CAGCATCTCGGCGCCGTTGCGTGACGGACGAAAGCCCCGGGGTCCTTCCTCAAAGAGNNNNNNNNNNCTTCAAATCTGGAGATCCGCTCGGAACTGAGCT
GATCACGGGAGACGCGTGGATCTTNNNNNNNNNNTTTCAATTCTGGAGATCCGATCGGAACTGAGCTGGTCACGGGAGACGCGTGGATCTTATTTTAGCC
AATCAGAGTCGACTGCGTACTTATGCAGCGTGTCGTCACGTCGCAGAAAAGCGAACTTAACGGACCAGCAGCACCTAGTAAAATCATTGAAGCTGACAGC
CCAAAAACCACCGTGTTTTTCCAAAAACCACATGTACTGTCTTCCGGTTATTACCNNNNNNNNNNCTTAACGGACCAGCAGCACCTCGTAAAATCATTGA
AGCTTCCGGCCCAAAAACCACCGTGTTTTCCAAAAACCACATGGTACTGTCTTCCGGTTATTACCGTCATGACCGCAGGGTTCAAAGCACGCGCCCATCT
TCTTTGGGGGTCATAATCAGAGTCACTAAAGCGGGGGACACTGTGCCCACTGAAGCGAGCAGAACAGGATGGAGCACTTTCTCGGGCGATTGTCTCTGCT
GGCGGACCGCGGCGTGTGCATCATCCGGGTGCAAGTGGGTTCCTGCGCGTGGGACACTGCGACACGAAGGAGGAGCCGTTGACTCACACAGAGAACTCGG
TCGCGACGCGCGTGTCCCTCCATAGTGATCCCCTCGGCGGCGCCGTAGCTCTTCATATCGCCATTGTCGAGACACCCACGATGGACACCAACTTGATGCT
CTTCATCTTGCTCCTGTCGGTCATCTACACGGTTTGTACCGTATGGATATGCCACGTGCGCTGCAAGGCTCGCTGTTCGCGAGCCGCTTCNNNNNNNNNN
NNNNNNNNNNNNNNNNNAGAGCGCCGAGAGAGACGCGCTTCGTTGCGTGCAGGGCTGCTGGATGGGTAAGGAGACGGACGCCTGCCCGTACAGGTGGTGG
TGGACACTTTCTCACATCCTCTTGCTCTTCCTGTTCGCTGACAGCGAGGGCACCGTCGAGCACCGTATTGATGCAGCCACTCGGTACGCGTCCGTTTTGC
TTTCCGTCTAATAGTCGACCTGTGGACTAATCACTTGACGGTGCACCAGCGATGCGAGTGATGGTTTTGAATGGTGCACGTACTGCGAGTTTGCCAACTT
CAAGCGGCTCCGCTACTGCGCACTGTGTGGCGAGCGGCTCCAGCGCACCTTCGATATTCTCTACGCGGACGTGAGACCTTCTGATCGGCTGCGGAGATCG
AGGAGACGCAAAGAATGGGGGCGACGAATCGACCTCGAGGGGCGTGCGTTCTGGTACCACGCCAAAGTGCCGAGCAAGAGTGATTTGGCACAGGGCTACG
TGCTTCGCTTCGAGACTCCGGCTGGTCTTCCCGAGCACGAACCCGAGTCGGAAGCCTCCACACGGAAACCGCTCGTCGGTCAGGTGCTCTTGGCCGAAGC
CCAGGCGGCGACCGTCCACATTCTGCCGGCAGCCTCGGCTGATTCCAGCGTGTTCCCGGACGGCACGGCCACCGATCTCAAGACGCGCCATCGCGACATT
TTGCAGCTCGCCGAGAAGGAATTCCCGACCAAGTTTTCCCACTTTGTCGTGTGCTCAGCGTCGCTGCTCGTGCCCGCTGAAGTCGAGGCGCTCCAGATCT
CGCTGCACCGAGACTACCTCGTCGAGGAGTCGATCCACCACTTGAGC