Description :
From Genome Similarity Track
Location :
Scaffold_2079:268- 3296
Sequence
3028 bases(100 bases per row)
GCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGGCGCTCTATCTGGCCGTCTGTCTGCGGGTGGTCCGCGGTGGACATCTGCAGACGA
GTTCCCAGTGAAGGAAACAGCGTTTTCCAAAACGCAACCGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGC
CATCTACGGACAACTTGCGGTTTGTTTGCCCGTAACAGTGACGGGAACCGGAGCAAGATGGTACATCTTGCTTAGCCGACAGACGAACACCAAAATTCCG
GTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGTCAAGACTCATCGACTTCCAACAGTCAGCCGGTACGTGCAGGCTCTGTAGTGGAGCCGAAG
AGTGCCCTGTGGGTCTGACACGCTGAGATGATCCACATGTCTTCACATATCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGCCTAAGAGACCGA
CAGAAAGGTCTTCTCGCGGCCCAAATGGCCGCTGGAGGGCGCGTCGTGCGCCTCCGCGAGGATATCGAACTTCAGATCCTCGTCGTTGGGTACGACCACC
CGTGGAGGTTCATTGGGCTCCACCCGGTAATAGAGGAGGCCATCCCATCCTTCAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAATC
GGACTTCGCGCTCGTTCCTGTCGTGAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGTCATGCGTATCGATCATATAGCTCCGTTGTCA
CCCGTGTGATGTGGGCCAACCCATAGTCAGGACGCCGAGAGAGGGCGTCCGCAAGCATGTTGGTCTTGCCCGGCTTGTATTCGACGCGGAAGCTGTACTC
CGCGAAGAAGGACAGCCACCTCGCCATCCTTTGGGAGAGGTGAGGCGAGTTCGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCATGAAGGGCCTG
GAGCCCAGAAGGTGAACACGAAACTTTACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCGTGGACAGGGTAGTTCCGCTCGGCGACTTTGAGCTGCC
TGGACTGGAACGAGATGACTCGTTCATGCCCAGCCGTGTCGGCCTGCAGCAATGCACACCCGATAGCGTAATCGGAGGCATCGCAGACGACGCTGAACGA
CTTCGTATCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGCCAAAGGCATCCTGGTGCTCTTGCCCCCAGCGCCAGTCGACG
TCCTTCTGAAGGAGGCCCGACAAGGGCTTAGCAAAGCCCGCGAACCCCGCGCTGTACTTGTGAAGGTAGTTGGCCAATCCCAACCACTTTCGGAGATCCT
CTGGGATCGAGGCGTTGGCCATGCTGCTACGGCCTTGACCCTGTCTGGGTCAGCCCGAACACCCACGTTACTTACGAAGCAACCGAGAACTTTAATCTCT
GGTGACGCGAAAACGCACTTGTCGATGCTGGCGTAGAGCTTGTTTGCTCGCATTACGTCTAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCG
TCTTGCCTCCCTTGGCACGGCTATGGACGAATATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACATTTGCGTCACCAGGCGATTGAA
CGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGTCACTTGGAGTGCTCACCGCGGTGAGCGGGATGGCGCTCTCACGC
ATCAGGATCTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTACCAGCCATGTTGTTTAAAAGCACATCCTTTCGTGGGATTGGTGTTT
GGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACTAGACGCCACTTTCCGTTCGCTTCCGAACGCAGAAAGTCGGCGTCGAGTGCGGGGAT
TTCGATTCCCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGCTCGCGCGGGAGAGGCCATTGCCTCGTGACACAAT
ACTTTGTGCCGAGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGAAGTTGGGTCGGTGGGTGTTTGCTCACCACGTCCCCATACTCCGTCAC
CAAAGGATACACCCAATCCTTGGGGTTCTTGAGAATCTCAGAACCCAAGCGCGCCTGACGCTGCTTGTTCAGGTCTTCCAGGACGTTCTCGTCCAAGACA
GAGGAGGAGTTCAGCTCCTCCTGAGTGGTCTCAGGTCTCACGAGTACCATCTCAGCAATCTCTCCAGCCTTGAGGTTGGCCAGGAAAGACTCAGCCGTCA
TTTCCTCGAGGTTCAGTATCTCCGCAACCTCTGGCAACGGTTCCAAGTGGACACCAGATGCCTTGACGGGTAAACCTGTCTCGCCATCGAAGATGTGATA
ACACTCTTCCACCGGCCTTGTCGGAGGAGCCCGGGCCCTGGACTCCGAGTCGCTTGAAGCGACGTCGATCGGAACGAAGCTCGGATCCGACTTGAGGCGG
CGGCGGTGTCTTTGCCGACGGCGTCTGTGACGGGGAGCTTTGCTGCCCACGTCTAGGGATGTCGTCGCTACGACATCCGAGGCACTCGTGGCCTTGTGTG
ATACTGTTGTACCCACACAGGAAGCGTGTTCAACGCCTTTCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCATG
TTCAACGCCTTCCTCTTCAGTTAAGGTCTGGGCGACCGCGTGTGGCACTGTGTTACCCACACAGGAAGCGTATCCGACGTCTTCCTCTTCAGTTAAGGTC
TGGGCGACCGTGAGTGGAACTCTGTTACCCACTCTGAACACGCTGTTCTCAGTGTTCATGACAGCTGCAGCTGTCTGCGGAACTAAGTTACCCGCCTGTG
GACCATAAGTTACCCACTTGGCCGACGC