Description :
From Genome Similarity Track
Location :
Scaffold_3787:268- 2083
Sequence
1815 bases(100 bases per row)
CTCCCCCACTTAGAATAGAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGA
CGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGC
ACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACG
CAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGGTTTGTTCGCCCGT
CACAGTGACGGGAACTGGAGCAAGATGTACCATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAG
ATGAAGTCAAGACTCATCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTAACCCGCTGACATGTTT
CACATGTCTTGACGTACCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGACCGCT
GGAGGGCGCGTCATGCGCCTCCGCGAGGATGTCGAACTTAAGATTCTCGTCGTTGGGTACGACCACCCGTAAAGGATCAGTTGGCTTCACCCGGTAATAG
AGAAGGCCATCCTTTAACTCATATCGGTGGAGCCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCTGCCATAAGGAACTTGACGA
TAGGCGCGACAGCCTGATCGTCCCGATACGCCATGCGTATCCGATCATATAGATTCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCAGGACGCCG
AGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTATTCGACGCGGAAGTTGTACTCCGCGAAGAAGGACAGCCACCTCGCCATCCTTTGCGAG
AGGTGAGGCGAGTTAGTCGCCGTCCTCAAGGACGCGTGGTCTGTGTAGATCACGAAGGGCCCGAGAACCCAGAAGGTGAACACGAAACTTCACAAGGGCA
TATTTCATTGCCAGGGAGCTTCTTGTCGTGGACAGAGTAGTTCCGCTCGGCGGCTTTGAGTTGCCTGGACTGGAACAAGATGACTCGTTCGTGTCCAGCC
GTGTCGGCCTGCAGCAATGCACATCCGATGGCGTAATCCGAGGCATCGCAGACGACGCTAAACGGCTTCGTCTCGTCCGGCAGGGCCAGGACAGGGGCCT
TTGGGAGAATGGCCTTGGATGCTTACAAAAGAATTCCTGAGGTTCCTGCTTCCAGCGCCCATTCGACGTCCTTTTTGAGGGAGCCCCGACAAGGGCTTAG
CGAAGCCCGCGTACCCTGCGCTGTACTTGGGAAGGTAGTTGGCCAAGCCCAACCACTTTCGAAGATCCTTCTGGGATCGGTACGTCGGCCATGCTGCTAT
GGCCTTGACCTTGTCTGATCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACTTTAATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGG
TGTACAGCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCTCCATGGCCGTATTGCCTCCCTCGGCACGGCTATGGACGAA
TATGTCGTCGAAGTA