Description :
From Genome Similarity Track
Location :
Scaffold_3038:268- 1822
Sequence
1554 bases(100 bases per row)
GGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGCTAACTTCCTCTAGCGCAACGTGCTGTGTGACCCCGTCACACTTGGTAGCAC
TTGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGCCTCTCAGTT
CGAGTCGGTTCAGAAGATGACAGGCATCTTCGGGATGGAGGCTTTGCAGAGTCTGGTGGTGTCAGCACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTT
GACGCGTACGAGCAGGGGCTCATCGCACATGTGCGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCTGCCTCACCCGAAGCCAATACGGCTGAAGG
TTAAGCCGTATGAAGGGAAGGAAGGCATGAACCTTCACTTCTGGGTCTGAGAAGTAGGGCTCGCGATGGACGCAGCTCTGATCTCGACCGAGCAACTTAG
TGTTGCTTTTGCACTCTCCAACCTTAACGGCCGTGCTAAGAGTTGGGTGTACACACGGGAAGCAACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTG
CGTAAACAGCTCCGAGCCGCGTTCCTCCCGGCGATCTACGAGTACCGCCAGCGAGTACGTGCAAGAGATACGTGAGCTCACGGTGTCCCTAGTGGGATAC
CCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGGTCCGGGTGCAGTCAAGCACCCTTGAAG
AGGCGATTCAAGTGGCTCTTCAAGAAGAGTACATCCATCGCCAGGCGCTTACGCCGGTCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAAC
AAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGTTGTGGGAAGATGGGCCACTTCAAGCGCGACTGT
CCCGCGGGAAGACTCCGCAGACGGTCTTTCCCCAAGACCATCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACACCGGGAACCAGT
AGGGGCGAAATGCCCTACTGGGGAAGAGCTAAGTGTTTGTGATTGGTGCGTACCACGAGGACTTAGCCCCTGAGAGGCTTCGCACTTTCGAATCGGCGAA
GAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCACGC
CGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCGACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGATCG
TCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGACCCATATGATATGAT
CCTGTGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAA