Description :
From Genome Similarity Track
Location :
Scaffold_2053:268- 1465
Transcript NameFunction/comments
Phymu_g13847hypothetical protein

Sequence
1197 bases(100 bases per row)
AATAACAGTTTtcattttacggtattttCGCAGTTTAATTGCTTATATTTAGTTTATTTATACTTATTCACATCAAGTACaactaattgcacgcttcctc
aGCTCGGTAAGAGACTTCGCACCGAGCtacttcgacgacgtgttcGGCCATAGCCGGGCTAAGACTGAAAAGACGGACGTTGAGATGGACAGGGTGCATC
TCTGGAAGCTGCTAGAGCTTGTAAGGAAACATAAGCTTTATGCGAACCTGAAGAAGTGTATCTTCGGGGCGAGCAAGATGCCCGTGCTTTGGTGTCTCGT
CGGGACGGACACGTACGCCCTGACCCAGAGAAGGTCAGAGTGATCGATGAATGGCCCACGCCATTCAATGTGAAGGAACTGAGGCGGTTCCTTGGGctcg
ccacgtacttgagcaagtacgtggagaacTACGCGGGCAAGATCCACCCGCTGTCACAGCTTCTTAAGAAAGAAGCTGAGTGGAATTGGACCATCGAGTG
CCAAGGGTCATTCGATACAGTTCAAGCATGGCTTGCCTGAGGCGCCGATCTTGGCAGTGGCTGACCAAGATCGTCCATTCCACGTGGTGTGTGACGCACC
CGACTTTGCGATCGGATGCGCATTGATGCAGCACGATCACGAGGGGCATGATCGTGTGGTCTACTACCAATCGCGTGAGCTGAAGCCAGCTGAGTGTAAC
TACTCCGTACATgccaaggagctccttgCCTTGTAGTATACATTCGCAAAGTTCCGAGTGTATATACTTGGGAGTAGACCATTCGTGGTCTATATAAATC
ACGCATCATTGCAGACAGCTATCAAGTCACAGCACATCGCGCAACGTATGGCGAGATggttgtccttcttcgtggagcCCAACTTCCGGGTTGAGTACAA
ACCCGGAAGACTCAACGTAGTGGCCGACGCGTTATCGCGTCGACCTGTCCATGCGGAGACAGTCGACGTCAACACAGTTGGCGTCGTGAGGCCAAGTGTT
CCGTCGTAATCGTTACTTGGCGACGTGAAGAGCGCGTATGCAAGACATGCAGACGCGAAGGGGCTGCCGGAGTACCTCACAGCACCTTCCGACGAGGCGC
GTCGGAAGCTAACCCCTCAACTTCGGGCTCATGTACACGGTGTGCGACTGCAGTACTGTGCAGTAGGCGACAACGCGAACCGCATTGCCGTTCCAGT