Description :
From Genome Similarity Track
Location :
Scaffold_1483:268- 1300
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1483-snap-gene-0.3Nucleic acid binding protein

Sequence
1032 bases(100 bases per row)
GAAGGCGTGAGTGCCATGGTGCTGGAAGGGCCATTTCTCTTTGTGGGCTTTGAAGGGCCGTCGCCACACACGCCCAAGGTCGGCGTGGGCATGGTCCGCG
GCTGGAACCTGGAGAATCCGGCGCAGACGTACGAGTTTCGCGTGAGCGACGCCATGCCCTTTGCGCACTCGATGCCCGTGCACTCACTGGCGATCGCGAC
CGACTCGTCGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACGCGACGCTGTTCAGCGGCAGCGCCGACGGCGTCGTCCGGTACTGGCAACT
GGATCCAGCGACCAACGCGTTCAAGTGCCGCGGCACACTCGACGGCCACGTGCGCAGCGTCACGCGGCTCAAGACGTTTGTGATTGGCACGACGCCCATG
TACGTTTATCTATTCTTCTAGTTTCATAGTGGAGAGAGTACGTCGTGCTGACGATCTCTTGTAGTCTGGCGTCGGCGTCGGTCGACACGACCATCCGGCT
CTGGGATTTATCCACGTACCAGTGCGTCAAGGTGCTCTCGGCCGACGACAATGGGCACACAGACGCTGTGATGGACCTCGAGTTCTGGGTCAACAACGGC
GAGACGTTTCTCATCAGCGGCGGCTTGGATTCGGAGATTATCGTGTGGAGCATGGGCGGCCAGTTCCAGCAAGTGTTCAAGGAGACCCAGGACGCGCAGG
TCACGGCGCTTTGCGGCACACAGGATGCCGCGCAAGTCGCACTGCTGCTCGTTGGTACCTCGGTGCGTGTGGTCACGTCAAGCCCTTCGTGGCAATAGCG
TATTCACTGATTTGGCTTTTCTGTCTCTTCCAGGATGGTGCGATCACGGTCAAGGAGCTGCCGACGTTTGCGTACAAGACCACCTTCAGCGCCGGCGCCA
ACTTTGGCCACCAGGACGTCGTGCGCCGCATCACCACGGGCCCACTCAACACATTCTTCAGCGTCGCCAGTGATAGCCGCATGATCGCGTGGCAGATTGT
GGGCGACGCCAACTCGGTGCAGCCCAAGTAAG