Description :
From Genome Similarity Track
Location :
contig_184:26797- 27800
Transcript NameFunction/comments
g14108.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
AGCCACCCAGTGAGACTTGTTGTACCGCTCGCAAAACTTGGCCACTTCACCCACAGCTTGAGCAATGTCCGGGCGCGTACAAGTTGCGAGGTACATCAAA
GCCCCCACCAACTCGCGATACGGGTACCTGGGCACGAAATCTTCGTCTTCTGACGGCTTCACCAGCTTCGAGTTGCTGTCCGCTGGTGTGTGCACTGCCT
TGCACTTTTCCACGCCGAACTTCTCCGCGAGTCGTTGAATATACGCTCGCTGATTCATGACGATGGTCTTGTCGTCGCGGTTGCGGTGGATCTCGATGCC
GAGACAGTACTTCAGCTCACCGAGCTCCTTGATGCTGAACTCGCGCTTCAGCGCCTTCTTGATCTCACCGATCTCCGCTTTCGTCCTGCTGAAGATCATG
AGGTCGTCCACGTAGACGATAATGATGCTGAACTTCGAGTCCGAACGCCGAACATACACACACGGATCCGCCGCTGACCGATGGAAACCTTGGCCCTCCA
GGTGCTTGTTCAGCTTGCTGTTCCATTGGCGTGCCGCTTGCTTCGTGCCGTAAAGCGCTTGCATCAACAGGCACTTCTTGGTTGGGTTGACTTGGTCTTC
AAATCCGTCCGGCTGGTCCATATAGAGCTCCTCTTCAACGTCGCCGTAGAGAAACGCGGTGTCCACATCCACATTTTCAGCCTCCATGTCTTCCTCTGCT
GCAATCGCCACCGCCGTGTTGATGGACTCCTTGCGTGCTACAGGAGCGAAAGTCTCCGTGTAGTCGACCCCTGGACGTTGCGTGAAGCCCTTCGCCACGA
GACGAGCCTTGAACTTGATGATCTTCCCGCTCGGGTCACGCTTGATACGGAACACCCACTTGCACCCGATCGCCTTCTTGTCTGACGGCATGTCCACCAA
CTTCCAGGTGCGGTGATCCTCAAGCGACTTCATTTCGCTTTCCATGGCGCGCAGCCATTCGTCCTTGTACTTGCTCCGCATGACTTCATCGTACGACACC
GCG