Description :
From Genome Similarity Track
Location :
Scaffold_9:267957- 269683
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004247Similar to PTR2: Peptide transporter PTR2 (Arabidopsis thaliana)

Sequence
1726 bases(100 bases per row)
CACGCCGAGCGGCGCGTCGTCGTACTACATCGACGGGCCCTGGGAGCAGCGCAATCACCAGTTCCAGAACGTCTTGCTGAGCGTGTCGTCGTTCATCCTG
ATCCTCGAGTTCGCCGAGCGCGTGAGTTATTATGGCATCAACCAGGGGCTCAAGAACTTTATGGGCCAGAACCTCGGGTGGACCCAAGCCGGATCGAACT
CGATCAAGAGTACGTGGACTTCGATCTGCTACCTGACGCCCGTGCTCGGCGGATACATCGCCGACGAGAAGTGGGGCCGCTTCAAGACGCTCTGGGTATT
TGGCATCTGGTACACGGTCGGCGCGTTCCTCGTCACGATCTCGGCGCATCCGTCCATGAACGACGAGGAAGACCACCTGCTCGCCAACTTTGTGTGCCAC
ATTGGCTTGTTCGTCGGTATTGCTGTCGGTACAGGCGCCATCAAGGCGAATGTGATCACATTCGGCGCCGACCAGTTTGATCCGAACGATCCAAATGAAG
TCGCGCAGAGCGCCAGGTTTTTCAGCTACATCAACCGAGTCGTGAACCTCGGCGCGATCTTCTCGTACGGCTACCTGTCAGTGCTCTGTGTGAATGGCTC
GGGCGCGATCCCGAAGGAGTACGGCTACTTCGCGACGTTTGCGGTCTGCGGCGGCGTGATGGTGCTGGCGTACGCGCTATTTGCGATGGCGTATCCTCGC
TACGTGCACTTTGCGCCGGAAAAGAGCGCGCTCTCGACACTCACCTCCATCGTGAACGGCAACTGCGAGTACAGCAAAGAGGCGCGCATGCTGCGCTATG
GATTGGTCGCGTTCGCGCTCGCGTTTCCACTGAACCTGCTCGCGGCATTTCTGTCAAACACGGCTTCGTCGGGTCAGTATTTGTCGTACCTCGTCGTAGC
ATGTTGTCTATTTGGCATGTACGCGTGGATCCGGTACGGCATGAGCACAGCGTACATGGACAAGTCCAAGGCGTCCAACGGTGGCCGATACAACGACGAG
ACGGTGGACGACATCAAGATGGTGATCCGTGTGCTCCCGTTTGCGTGCTTTATGATCATGTGGGAGTGCGCGTACGACCAGTTAGATGCGAACTTCCAAA
GTATCGCGCAGCAGTGCGACCTCCGGCTCACGAAGGACGACGACGAGCACAATGTGCAGGTTCCCGGCGCGAGTCTCAGTATATTCGACCCGCTGACGAT
CATTGTGCTCATGAAGATCTTGGACAAGTTTATCTACCCGTTGTACCAGCGGATCGTTGGAAGACCGCCTGGTGCGTACGGCAAAGTGCTCACGGGGCTC
ATCGTGGCCATGCTCAACATGTTTTGGGCGGGCACGTTCGAAGTGATTCGCCGCAACGCTGGCCCGCTGCAGTACTCCAATGCGACGGGCGTCTACGACA
TCTTGGACACTGGATCGCTGCAGCCGATGAACAACATTTCGTGGGGGTATGCGGTCTCGATGTACGTATTCACGGCAGTCGCAGAATGTCTAATCAACAT
TACGGCATTCGAGCTTCTCTACAGCGAACTCCCGGTGTACCTGCAGGGTACTTGCCAAGTGATCGTGCTGTTCATGGTCGCTATGGGCAGCAACCTCACG
TCGACGTTCACGCTACTGTTCCAAGGCTACATCACGGAGAACCTGAACGACGGCCACTTTGAGTACATGTACTACACGCTGAGCGGCCTGAGTTTCCTCA
ACATCATCGCGTTCGTCGTGGTGATG