Description :
From Genome Similarity Track
Location :
scaffold_191:26793- 29432
Transcript NameFunction/comments
Pl_107979conserved hypothetical protein
Pl_107980hypothetical protein PHYSODRAFT_562920

Sequence
2639 bases(100 bases per row)
ATTTCGTCGAGAAAAGCATTGAGGGTGCGTGGTGTTGCCTGATATCAAACTTGGAGAACTCACCCGTCATCATCCGCTGATTCGTTAGGGTCTGGATGAA
CTTCGAGTGCAGGTCGATGGTGAGGATGTCGTGTTACTGGCCAATCAGGCTAAGGAGAGGTTCTCTTCCATGCTAGCTTATGACAGTCAGGAACCTGAAG
CGTACAAGCGCGAGAAACAGCGAGAGCTTGCGGAGGCACTCTCAAAGCGGTCAGAGTTGTCGGATGTGGAGGAGATGCAGCAACGATTGCATGAGAAGAC
TATGGCTCGGCTGAAGCAATACGAGCAGATGGATCAAGTAACTCGTAAAACGATGAAGTAGCAGTACTACTAGCACCTTGATGACCTCAACTAGGTCAAT
GCCCAAATGTTTCGTTGTCGAAAGAGATCGAGGTGGTTAACTGTAATGTACCAGCTTCGTTACTTGCTGTCTCCGATAGTTCGACTGTCGCCTGTTGCAG
CCACGATGCGTGTCAGGTCAATGTGGTGGTCATGAGCAACCACAGACGCAGGATTTGCGGCGCCAAGCAGTAAACTCACGCGTCGTTTCAACTTCAGCCG
AATCTGGTTAAATTGCAAGCAGGATTTGAAGTGCAGCATAGATACTCGTGCGCTAAAGATGGCGAAGCAAACACGCATGCCGTCTGAATGTTGAAAAATG
CTGCTTGGGTTGAAGGAGTCACAGCTCGAAGCAGAAACGGATCGGGGTAGAGCACCAGCGATCAGCATGCTATGCTGCGTGTCTGGACGACACTGAAGTC
GAACCAAGCAGCTCGTGCGAGGCAACTTCAATCACATTGAGCAGCGCCATGGCACTCGGAACAAATGGCACGACCAGCTCAAGCTGGATCTGCAACGTCA
ATAACATGCATGCACACACGACCAACCTCGAAGTGGTCGCGCAGTGGCGATCGTGTTGATGGCGAGGATAATGAAGAATTGCGATGATTAGGAATCGCGA
TACCTTGTACTCCACAACTTGCATCCGAATCAACACGCGCGACGCGAAACGAAGCCTTATACCAAATTGGCGTTGGTCTCTTGAACGAAACTGGGCAATT
GTCTCTGCTAGCAAACCATTATCACCCGAGAGCCATTGGCTTTTGCCTCGGAGGCAACTTGCTCGAATGATGTGCAAAAATTGCAATTCAGCGGATTTGT
GTTTGGATGCCTACATTTGTTTGATGCATGCTGCTGTGCCCGTTCAAACGGGGGCATCAATGCTTGCTACTGTAACCGTCCCCACTTCTAACCTCTGCCT
TTCTAACCAAGCGCAGCTTCCAGTCGGTCGCTATAGCCGAGCATCTTCAATTTGGCAAAGGCCACAAAAGCGTGTCACCTAAAAAGAATTGCCTGCCACT
TAGACACAGGCCACGCACGCCGTCCATCCGGACCGCCATTCCAACTCTTCCCTCGTCCTCCAGAGACCTCAAGACTTGTAGCAATGGTGGCCATCGCGAA
CGACAAGAAGGCAACGACCGGCGGCGTCGTGGCGGCGCGTCTACTGGGCTCCACGTGCTCCGGTCTGTGCGAGCTCATGATCTTCCACCCCGTGGACACC
ATCGCCAAGCGTCTCATGACCAACAAGGAGCCCATGCACGGCGTCTCGGGCCTCAACAAGGTCATCTTCCGCGACGCCTACGAGAAGCCCGTGTTCGCAC
GCTACCGCTCGCTGTTCCCCGGTTTGGGCTTCGCTGCCGGCTACAAGGTCTCGCAGCGCATCTACAAGTTCGGTGGCCAGCCTGTCGTCAAGGATTACAT
GACCAAGAACCACGCTTCCTTCTTCGAGCACACGTTTGGTGAACGTAACGCCAAGACGATGATGCACGCCACGGCTGGAAGTCTCATTGGTGTTGGTGAG
ATTGCTCTATTGCCGCTGGATGTGCTCAAGATTCGCGCACAGACCAACCCGGCTGCCATTGCTGGCAAGGGAGTGGCTCACATCTTCAAGACGGAGGGTT
TCGCCCTGTACCGCGGCGCAGGCTGGACGGCAGCGCGTAACGCGCCCGGCTCATTCGCCCTGTTCGGTGGCTCGGCGTTCGCCAAGGAATATTTGTTCCA
GCTCGAGGACTACAACAGCGCTACGTTCTTCCAGAACTTTGTGGCTTCCATCTCGGGTGCTTCGGCTAGTATTATTGGTAAGTTGGCACTTGTGGTTGAT
ATGCCTGTCGTATCGTTCCAGTGATGTTGACATTGTGTTTTCGTGTGTTCTAGTGGCACAGCCGCTTGATGTGATCAAGACGCGTATCCAGTCTCGTCCG
TTCGACTCGCCTGAGAGTGGCATGACGGTCGTGCGCAACCTGCTCAAGGCTGAGGGCCCTGGTGCTCTGCTCAAGGGTCTGATCCCCAAGCTGTCGGTCG
TTGGCCCTAAACTCGTGTTCTCGTTCGCCGTGGCACAGCACCTGATTGCGTACTTCGAGAAGTCCTTCACCTCGTAGGTAGAATATGATCGTCGGAACTG
CAACCACCAAGCGAGCGATAGAGGGAGGAGAGGAGACAACTCGCTGTCCGACACATGATCTGAATGTGCTAGAATGCGTGTACTGAGGTTATCACGCGCA
GCACCTTCGTTCTTCTGCATCAACACTCGTGACACATTT