Description :
From Genome Similarity Track
Location :
contig_50:267924- 270487
Transcript NameFunction/comments
g10384.t1hypothetical protein

Sequence
2563 bases(100 bases per row)
GCGTTCACTGTTGTCTTGGGACCCCAGCCTGCTTCCTTCAGGAGACTCTTGTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTA
CTAAGGTTTTCAGAGCTCCGCGAGTTCGCTGCAGCGCCACGAACACGATTGAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGC
CGCAGTAACACGATCTTCTCCGAGACGGAGAGCTTCTTGAAGTGCTGCGACAACAGTTGACCTCACCTCCTGACGAGTCTTTGACGTGATCAGCATCTGG
AACGAAGCACGGGCGGCGGTTGCAGCGTCTTCATCTTGTGTGGCTGTCCGTCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACAT
CAGCTCGTGGAGTTACAAGTTGGGCCATGACGTGCTCACACACGTCTGTCGTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCAC
CTTGAAAACCGCCTCGGAAAGCTTGTCGTTTTCTTCCTGGAGCGGCGATAAAGTGCCGGGGAACGCCGTTGTCGGTGACTTCACTCCGGAAGTGGCTGAG
TACCCATCGTTGTCATGCTTTGAAGTGAAAGACGAGATACCACCGTTCTGGTCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGA
CCAGCTGGCCTTTAGTTATTCGTCCGGTGCCAGTCGAGAGTTTCCTGCGTGGTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTC
GCTCACGCAGCTCTGGACAAACACTTGGCTGTACAGGAATGGCAGGTGGTCTTCTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCC
AAACGCACGTTAGACGGCGGAAGGAGTTCTTCAGACAGATAGTCGCCGTTATGTATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTT
GCATCGCAATGTAGAGTCCTGTCTCGCCCAGGGAGTTCAATCGCGGCGACCGATACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCC
TGAAGACAGTTTATCCAGCGAAAGCATCGTCAGATAGTCACACAGCCACGGGATGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTC
TTAACGTCGAGACTGGAGTCGCGCGCCACCTCTAGTGTGCTGATGCCTTCACGCTCGACAGCCTTGAACGCAGCATTTTGCTCAGAGAGCTGGCGAATCG
AAGACGTGACTTCCCATTGCGGCGAGAAGCGCAGATATCCGAGGAATTTTGCCATCACCTTGAGTCTTAACACCAGTTCTGTGAAGTTGTTCCGAGCATC
AGCAGAGGGGGAGGTGTTTTCTCGAATGGCGTAGAATTGCCGCTCTAACTGGTGTTTGACAAGCTCGGAGAACTCGTAGCTATCACAGCTGTGCAGGAAG
TGAAAGAAGAAGAGCTGGTTGTCCGTAAAAAAACTCTTCATCCGATCAAGCGTTGCCGTGAACTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTGG
TGTCCTGCCGGGATTTCCATGGCGAATTGTTGTTTCCCTTGGCGCCAGTCCTGTTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGT
ACGCAGATGCGGCTGCGGTGACTTATTCAAAGGCTTTTGGTTTGAAAAGCGCCGATGCAGCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCC
TCCATGATCTTCAGCACAAGTTCCTTATCGCTTTCACCGAAGGGGTTGGAACCCACTTGCAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGT
TCTCAGGAAAGACCTCAGCTAGCAGCTCCCGCGCAGACGCAATAGCTGCTGCTGCCACACCTGCATTCTCGATGCCGACGAGACTGTGCTGCTTCTGCTG
GAATTGACGCAGTAAGCTGAGAAAGCCGTCCCGGACCTTCTCGCGGTTTGTGTACAAGAGGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTC
TCTTCGTTGAAAGGGAGTGCGAAGTCTCGCACGGCACTTGCTTTCATCTCAACTGGCAGCTGACAGCCGACTCGAGCACTTTCAGCCACTCGGAGCTCCT
CGCGCTGGCGAGACACTTGGTCAAGTCGCTCCAACATGGACGAGCAGATGCCCTCGGCGTCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCC
AAGATGTGTCAGCACCGGCTCAATCTCATGAAACACGATCTCTGCGAAGTCGAGACAGTGGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTA
CCACCATCACTCCCCGGCTGCTCCTCATTGCTGCTGCAAGCCGTGCAATTGGCCCGATACAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGC
TCACAAACCGCTCTCTGATCAAAAACCCGTACAGCCTCGCCGCTTGTCGGTTCACCTTGAAGT