Description :
From Genome Similarity Track
Location :
scaffold_323:26790- 28373
Transcript NameFunction/comments
g7258.t1 hypothetical protein PHYSODRAFT_560503

Sequence
1583 bases(100 bases per row)
TACGCTTACTGGACGTCAGCAACGCCGATGAGGATCTCCCGGCCCAGGTCGTCCGACAGCTTGTCGCCGCTGATCACCACGACGCGGTCGCCGGCCGACA
ACCAGCCCATCTTCTTGGCGTGGGCAATGGCCTCGGCAGTGGTAGGCGCGCGCTCCAAGTAGTCCGGGACGACCGGGTACAGGCCACGGTGGATCTGCAG
CTGACGGCCGACCTTGAGGTCCGTCGTGAAGCACATGACCGGCACCGTGGGTTTGTACTTGGCCACCTTCCGGGCCGTGTAACCCGTGCGGGTCAGCACG
ATCATGAGCTTCGCGTTCATCTCGTTGGCGGTTTTCACAGCCGACGACACCGCGGACTCGACGTCGGACGTGGGCGGGTCGAACTGGAACTTGGCCTGGT
AGTTGGGCTGCAGCAGGAGCTGGTCGGCCTCCTTGATCACCGTGTTCATAGTTGCCACCGACTCGATCGGGTACTTGCCCTGGGCGGACTCGCCACTGAG
CATGACGCAGTCCGCGCCGTCCAGCACGGCGTTACCGACGTCCGAAACTTCGGCACGGGTGGGGCGCGGGTTGTTCTGCATGGACTCGAGCATCTGCGTG
GCCACAATGACGGGCTTGCCGACGGCGTTACAGCGGTCCACCATCATCTTCTGGTACGTCAGGACCTTCTGGGCAGGCACTTCAACGCCCAGATCACCAC
GCGCGCACATGACACCGTCCGAAGCCTCAAGGATCTCCTCGAAGTTCTGGACTCCTTCCAAGTTCTCGACCTTGGAGATGATCTTAGGCGCGATGTAGTC
CGGCTGGTTGGACCAGTGCTTCTTGATGCACGAGTCCACGAACGAACGGATCTCGTGCACGTCGCTGGCCTTACGGATGAACGAGGCGGCGATAAAGTCG
ATGTCGTGCTCCACGCCCCAGTCCAAGTCGCGCTTGTCCTTGTCGGACAGAGCCGGCAGCTCGACAATCAAACCGGGGAGGTTCACGCCCTTGCGGTTGC
CGATCTCCTCCGTGTTCATGATGTCGCACGTGATCTCGTTCTTGCCCACGCTCGTGCACGTGAGCCGGATCAAACCGTCCGACAGCAGCACCGTGTCACC
GACCTTGACGGTCTCCGGTAGCTGCTGGTACGTGACGAAGAACTTGTCCGCCGTGCCCTTGAGCTCGAACTCCGGGTCAGTCGTGAGCACCACGGACTTG
CCCTTCTCCAGCTTGATCTTCTTGCCGTCCAGCATCTTTCCCGTGCGGATTTCCGGTCCTTTGGTGTCGTGCAGCACCGCGCGCAGGTTAAACTTGGCGT
CGGCCTCAGCGTGGACGCCACGGCACGCGCGCAGGTTGGTCACACGCAGTAGAGCCTCGTCGTACTCGGCGTGGGAGAAGTTGATGCGCATGATGCGCAG
TCCCTCGTTCGTGAGCTTCTGCAGCATGTCCATCTGCTCCGACACGGGGCCGATGGTGCCCACGATCTTGGTCATGGAGAACTTGGAGCTGCGCGGGTTC
TTGTAGAGCTCCGAGGCCGAGACGATGCTGCGTGCATTGCGCACGGAGTTTTTCACGGATCGGAGGGCGAGGCGGCGCAGCAT