Description :
From Genome Similarity Track
Location :
Scaffold_1687:2679- 3838
Sequence
1159 bases(100 bases per row)
AATTAAAGAACGCTTGGAGACCCTCCAACGTTGTACGCACGGTCACCTCACCAGCTGGTTCAGGAAGCGTTAAGCTCAAGAGTCGCTCGAAACACGTCTT
GGCGCCTGCATCGGTAAACTCCATGTCCACATACGGAAGAACCCACGGTGGCAGGGTGGACGAAGCCGGCACCGTAGGGCGAGTACCAGATAACACTCGG
TGAGACAACTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCG
ATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTT
GAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTT
ATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTGGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCT
GTGACGGGATCTTGAGAGTTGAGAGCCCCTAGGGTGTAACCGACCAAGTAGTAAATTCGGTTAACCTGTCGGATCTGCACAAGTAAAGGAAAAGCTCACT
AGGTTGTAGGATCTGGCCAATGTATTATCCAGTTATCACTACCAACACTAGATTCGCAATTCCCAACCTTCTCGGAGCTCGTACGGCCAATGTAGTTCCG
GTTCTTGAGGGCAGGAAGGCACTTGCGTGTCACTGTGCAAATTGGAGTCTGTATTGATATTTAAGCCTATACCTGCCTGGGTTTCTACCTTCTATGTCTT
TACATCTGCTAAATCCCTTACCAGGGCTCGGCTGACATGTCCCTTCTTCCCTGGACCACATACATCCCAGCTGTGTTATCTTCCCAGCTGTGTTATCTTC
AGATCCCCCGCAGATATGTGACATAATCATCATGGTCACCCTATTATGGGTACACTCATCCGGATCCAGGTCGCTTGGATCCACCTCACTGTAATGGTAC
ACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCGTCTGTGATC